Taq master mix

Manufactured by Tiangen Biotech

Sourced in China

2×Taq Master Mix is a ready-to-use solution that contains Taq DNA polymerase, dNTPs, MgCl2, and other necessary components for PCR amplification. It is designed to simplify the PCR setup process and improve reproducibility.

Automatically generated - may contain errors

Lab products found in correlation

Taq dna polymerase, by Tiangen Biotech (2 mentions) Dl2000, by Takara Bio (1 mentions) Tianamp bacterial dna kit, by Tiangen Biotech (1 mentions) 2720 thermal cycler, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Sybr premix ex taq 2, by Takara Bio (1 mentions) Bovine serum albumin (bsa), by Merck Group (1 mentions) Sanger sequencing, by Sangon (1 mentions)

Spelling variants of this product

2×Taq PCR Master Mix kit (11 citations) 2X PCR Taq Master Mix (4 citations) Universal Taq PCR Master Mix (3 citations) HotStart Taq master mix kit (2 citations)

10 protocols using taq master mix

Rapid Detection of R. solanacearum Phylotype I

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phylotype I mulberry strains-specific primer set MG67-F/MG67-R, in combination with the species-specific primer pair AU759f/AU760r, was used to identify R. solanacearum phylotype I mulberry strains strains in a single PCR assay characterized by providing the expected amplicons of 156 and 282 bp (Pan et al., 2013 (link)). Each PCR mix had a total volume of 25 μl and contained 1× Taq MasterMix (PCR buffer, 1.5 mM MgCl₂, 250 μM of each dNTP, 50 mM KCl, 10 mM Tris-HCl, and 1.25 U of Taq DNA polymerase; Tiangen Biotech), 6 pmoles of the primers MG67-F and MG67-R, and 4 pmoles of the primers AU759f and AU760r).
Initial denaturation was conducted at 94°C for 5 min, followed by 30 cycles of denaturation (30 s at 94°C), annealing (30 s at 60°C) and extension (30 s at 72°C), with a final extension step for 10 min. Subsequently, the PCR products were observed by being subjected to agarose gel electrophoresis.

Huang W., Zhang H., Xu J., Wang S., Kong X., Ding W., Xu J, & Feng J. (2017). Loop-Mediated Isothermal Amplification Method for the Rapid Detection of Ralstonia solanacearum Phylotype I Mulberry Strains in China. Frontiers in Plant Science, 8, 76.

+ Open protocol

+ Expand

Molecular Marker-Based Genetic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Experimentals. RAPD primers (2.5 µmol/l) are listed in Table I and ISSR primers (2.5 µmol/l) are listed in Table II. Taq Mastermix (2X PCR; TianGen Biotech Co. Ltd.) and the DNA molecular weight marker, DL2000 (Takara Biotechnology Co. Ltd.) were applied for PCR amplification. Other reagents that were used were all of analytical grade and have been previously described (26, 27) .

Liu X., Du J., Khan M.A., Cheng J., Wei C., Mei Z., Chen H., He T., & Fu J. (2020). Analysis of genetic diversity and similarities between different Lycium varieties based on ISSR analysis and RAMP‑PCR markers. World Academy of Sciences Journal.

+ Open protocol

+ Expand

Phylogenetic Analysis of Bacterial Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

The phylogeny of each strain was characterized using comparative analysis of the partial nucleotide sequences of egl and mutS genes. Primers were used for amplifying the partial egl and mutS genes as previously described (Poussier et al. 2000a; (link)Prior and Fegan 2005) . Fifty microliters of the reaction mixture contained 1× Taq MasterMix (Tiangen Biotech), 0.25 μM of each primer, and 50 ng of DNA as the template (Xu et al. 2009) . The PCR programs of the egl and mutS genes were performed as previously described (Prior and Fegan 2005; Xu et al. 2009) . Fifty microliters of reaction mixtures were examined by electrophoresis on 1.5 % agarose gels in TAE buffer. Bands were revealed by visualization with UV light after ethidium bromide staining. PCR products were sequenced by the Beijing genomics institute. The primers mentioned above were also used as sequencing primers.

Liu Y., Wu D., Liu Q., Zhang S., Tang Y., Jiang G., Li S, & Ding W. (2017). The sequevar distribution of Ralstonia solanacearum in tobacco-growing zones of China is structured by elevation. Eur J Plant Pathol., 147(3).

+ Open protocol

+ Expand

Molecular Identification of R. solanacearum Phylotypes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total DNA from each strain was prepared using TIANamp Bacterial DNA Kit (Tiangen Biotech, Beijing, China), according to the manufacturer's instructions. The phylotype identity of each strain was determined by multiplex PCR as described by Fegan and Prior (2005) . Pmx-PCR was carried out in 25 μl of reaction mixture containing 1× Taq MasterMix (PCR buffer, 1.5 mM MgCl 2 , 250 μM of each dNTP, 50 mM KCl, 10 mM Tris-HCl and 1.25 U of Taq DNA polymerase) (Tiangen Biotech), 6 pmoles of primers Nmult:21:1F, Nmult:21:2F, Nmult:22:InF, 18 pmoles of the primer Nmult:23:AF and 4 pmoles of primers 759 and 760 (all primers are listed in Supplemental Table 2) (Opina et al. 1997; Xu et al. 2009 ). This P m x -P C R a m p l i f i e s a 2 8 1 -b p Bu n i v e r s a l R. solanacearum specific reference band in addition to the following phylotype-specific PCR products: a 144bp band from phylotype I strains; a 372-bp band from phylotype II strains; a 91-bp amplicon from phylotype III strains; and a 213-bp band from phylotype IV strains. The PCR program was carried out in a thermocycler as previously described (Xu et al. 2009 ). Then, 5 μl of PCR product was subjected to electrophoresis on 1.5 % agarose gel, stained with ethidium bromide and visualized on a UV-transilluminator.

+ Open protocol

+ Expand

Molecular Characterization of Plasmodium vivax Drug Resistance Markers

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Pvcrt-o gene was amplified by a single-round PCR and Pvmdr1, Pvdhps and Pvdhfr were amplified by nested PCR, as previously described [21 (link), 34 (link), 44 (link)–46 (link)]. The primers, cycling conditions and sizes of the PCR products are shown in Additional file 1. PCR reactions were performed in a 25 µL reaction mixture that contained 1 µL of genomic DNA, 12.5 µL 2×Taq Master Mix (TIANGEN, Beijing, China), 9.5 µL ddH₂O and 10 µM primers. The amplification products were analysed by 1.5% agarose gel electrophoresis and directly sequenced. The PCR products were purified using filter plates (Edge Biosystems, Gaithersburg, MD, USA) and sequenced on an ABI 3730XL automatic sequencer. Bidirectional sequencing was performed, and all the products were sequenced twice using independently amplified PCR products.

Huang F., Li S., Tian P., Pu L.J., Cui Y., Liu H., Yang L, & Bi D.Y. (2022). Genetic polymorphisms in genes associated with drug resistance in Plasmodium vivax parasites from northeastern Myanmar. Malaria Journal, 21, 66.

+ Open protocol

+ Expand

Optimized Allele-Specific PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For optimized AS-PCR, the reactions were performed using final volumes of 50 μL, including 25 μL 2 × Taq MasterMix (containing Taq DNA polymerase, dNTPs, Mg²⁺, and Taq reaction buffer, Tiangen Biotech Co., Ltd. Beijing, China), 0.4 μM each primer, and 1.0 μL template DNA. All of the amplifications were performed using a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) with the following parameters: one step of 5 min at 95 °C; 32 cycles of 30 s at 95 °C, 30 s at 60 °C, 45 s at 72 °C; and one step of 10 min at 72 °C. All PCR products were detected by electrophoresis on a 2.5% (w/v) agarose gel containing GoldView Nucleic Acid Stain (an alternative to ethidium bromide, Xi’an Heart Biological Technology Co., Ltd. Xi’an, Shaanxi, China) in 1 × TAE buffer (pH 8.0) and were visualized under UV light.

Zhang C., Yao Y., Zhu J.L., Zhang S.N., Zhang S.S., Wei H., Hui W.L, & Cui Y.L. (2016). Establishment and application of a real-time loop-mediated isothermal amplification system for the detection of CYP2C19 polymorphisms. Scientific Reports, 6, 26533.

+ Open protocol

+ Expand

Molecular Profiling of M. tuberculosis Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNAs were extracted from 318 clinical isolates of M. tuberculosis and the standard H37Rv strain using the cetyltrimethylammonium bromide (CTAB) method. Two oligonucleotide primers, pncA-F (5ʹ-GCTGGTCATGTTCGCGATCG-3ʹ) and pncA-R (5ʹ-GCTTGCGGCGAGCGCTCCA-3ʹ), were designed by using the Web Primer website (http://seq.yeastgenome.org/cgi-bin/web-primer), and used for PCR amplification of the pncA gene with purified genomic DNA as a template. The PCR reaction mixture (25 μL) contained 12.5 μL of 2×Taq Master Mix (Beijing TIANGEN Biotech Co., Ltd., China), 0.5 μL of DNA template, and 0.5 μL of each primer pair at a concentration of 20 mM. The thermal cycling conditions were 5 min at 94°C for denaturation followed by 30 cycles of 94°C for 1 min for denaturation, 60°C for 1 min for annealing, and 72°C for 1 min for amplification; and a final extension of 10 min at 70°C. The amplified PCR products (719bp, genome sequences from 2289345 to 2288626) were verified by agarose gel electrophoresis and sent to Shanghai Invitrogen for sequencing using primers pncA-F and pncA-R. The sequencing results were analyzed and mutations in the pncA gene were identified by aligning them with the wild-type pncA gene (GeneID: 887497) of the reference strain H37Rv using the BLAST (bl2seq) program at the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Cao Z., Lan Y., Chen L., Xiang M., Peng Z., Zhang J, & Zhang H. (2019). Resistance To First-Line Antituberculosis Drugs And Prevalence Of pncA Mutations In Clinical Isolates Of Mycobacterium tuberculosis From Zunyi, Guizhou Province Of China. Infection and Drug Resistance, 12, 3093-3102.

+ Open protocol

+ Expand

Quantifying IKZF1 gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by using TRIzol Reagent ((Invitrogen, Carlsbad, CA). RNA was reverse-transcribed into cDNA by using a reverse transcription kit (Takara, Japan). The first round of polymerase chain reaction (PCR) was performed by using specific primer of IKZF1, 5'-CACATAACCTGAGGACCATG-3' (forward) and 5'-AGGGCTTTAGCTCATGTGGA-3'(reverse). Specifically, 2ul cDNA, 12.5uL 2×Taq Master Mix (TianGen Biotech, Beijing, China), 10pmol of each primer, and distilled water were mixed into a final volume of 25uL. The first round condition was 5min at 95°C, followed with 35 cycles at 95°C for 30s, and 57°C for 30s, then 72°C for 90s, finally stopped after 72°C for 7 min. The first round product was used as the template for the second round PCR amplification. The primers 5'-ATGGATGCTGATGAGGGTCAAGAC-3' (foward) and 5'-GATGGCTTGGTCCATCACGTGG-3' (reverse) were designed and synthesized according to the literature [13 (link)]. Condition was as follow: 5min at 95°C, followed with 35 cycles at 95°C for 30s, and 62°C for 30s, then 72°C for 30s, finally stopped after 72°C for 7 min. The RNA integrity was confirmed by cDNA amplification of the β-Actin at the level of mRNA.

Lin X., Zou X., Wang Z., Fang Q., Chen S., Huang J., Zhe N., Yu M., Zhang Y, & Wang J. (2016). Targeting of heme oxygenase-1 attenuates the negative impact of Ikaros isoform 6 in adult BCR-ABL1-positive B-ALL. Oncotarget, 7(33), 53679-53701.

+ Open protocol

+ Expand

Bovine Milk Protein Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lactoferrin (Lac), β-lactoglobulin (β-Lac), α-lactalbumin (α-Lac), casein (Cas) from bovine milk and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Streptavidin Magnesphere® paramagnetic particles (SA-MPs) were purchased from Promega Corporation (Madison, USA). 2× SYBR® Premix Ex Taq™ II (Takara Bio Inc., Japan) and 2× Taq Master Mix (Tiangen Biotech Co., Ltd.) were used for PCR amplification. The following phosphate buffers were used in the experiments: 1× PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄·12H₂O, 2 mM KH₂PO₄), 1× PBSM (1× PBS with 1 mM MgCl₂, pH 7.4), and 1× PBST (1× PBS with 0.05% Tween-20, pH 7.4). 1× TBE was used for 30% polyacrylamide gel electrophoresis, which consisted of 89 mmol L⁻¹ Tris, 89 mmol L⁻¹ boric acid and 2 mmol L⁻¹ EDTA.

Yu F., Li H., Sun W., Xu D, & He F. (2019). Rapid selection of aptamers based on protein microarray. RSC Advances, 9(17), 9762-9768.

+ Open protocol

+ Expand

Verifying Chromosome Rearrangement Breakpoints

Check if the same lab product or an alternative is used in the 5 most similar protocols

The breakpoints were further confirmed by PCR, and Primer Premier 6 was used for designing primers. For the normal chr 3 and chr 6, 2 Kb bases flanking the potential breakpoints were directly retrieved from NCBI. For the derived chr 3 and chr 6, 2 Kb bases flanking the breakpoints were manually spliced. The primes used in this study were as follows. F1: AATTCAAAACTCTTGTGTCACTTTG, R1: ACATGTTACCACAATTCATGCACT; F2: GGAGAGACAAAGGGAAGTGTCA, R2: CCCCTTTACAATCCCAAATTCAGG; F3: AGTAGTCTGTAGAGTCTGCTA, R3: GTCTTGTCTCACGCTCAG; F4: GCAGCTTTGAAAATGGTTACTTGG, R4: ACAATTTGAGAGAAAGTTGCAGGA. A prepared mix on ice was: gDNA 50 ng, forward primer 1 μL, reverse primer 1 μL, 2×Taq master mix (Tiangen) 10 μL, and add ddH₂O to 20 μL. The cycling conditions were set as follows: 5 min at 95°C, then 32 cycles of 94°C for 30s, 57°C for 30s and 72°C for 30 s, and finally, 5 min at 72°C. Amplicons were visualized on 1% agarose gel and further confirmed by Sanger Sequencing (Sangon Biotech).

Wang Y., Zhao Z., Fu X., Li S., Zhang Q, & Kong X. (2022). Detection of a Cryptic 25 bp Deletion and a 269 Kb Microduplication by Nanopore Sequencing in a Seemingly Balanced Translocation Involving the LMLN and LOC105378102 Genes. Frontiers in Genetics, 13, 883398.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!