The extraction of RNA from cells was performed using TRIzol® reagent (Thermo Fisher Scientific, Inc.). The reverse transcription of individual RNA samples was then performed using total RNA and a RevertAid First Strand DNA Synthesis kit (Fermentas; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol as follows: 25°C for 5 min, 42°C for 60 min and 70°C for 5 min. The newly synthesized first-strand cDNA was ready for immediate downstream applications, or for long-term storage at -80°C. mRNA levels in all samples were measured using qPCR with the DreamTaq Green PCR MasterMix kit (Thermo Fisher Scientific, Inc.) on a CFX Connect fluorescent quantitative PCR instrument (Bio-Rad Laboratories, Inc.). The RT-qPCR conditions were as follows: Pre-denaturation at 95°C for 2 min; followed by 35 cycles of 95°C for 35 sec, 58°C for 45 sec and 72°C for 30 sec; and 72°C for 5 min. Relative expression levels were calculated using the 2−ΔΔCq method with GAPDH as the housekeeping gene (19 (link)). The primer sequences used were as follows: Beclin-1 forward, 5′-GCT GTA GCC AGC CTC TGA AA-3′ and reverse, 5′-AAT GGC TCC TGT GAG TTC CTG-3′; and GAPDH forward, 5′-AAG AAG GTG GTG AAG CAG G-3′ and reverse, 5′-GAA GGT GGA AGA GTG GGA GT-3′.
Cfx connect fluorescent quantitative pcr instrument
Manufactured by Bio-Rad
Sourced in United States
The CFX Connect Fluorescent Quantitative PCR Instrument is a real-time PCR detection system designed for accurate and reliable gene expression analysis. It utilizes fluorescent dyes to quantify DNA amplification during the PCR process, providing real-time data on the amplification of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Vazyme (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Vazyme (2 mentions)
Trizol reagent, by Vazyme (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dreamtaq green pcr master mix kit, by Thermo Fisher Scientific (1 mentions)
Sybr green real time pcr master mix, by Vazyme (1 mentions)
Real time pcr master mix, by Vazyme (1 mentions)
3 protocols using cfx connect fluorescent quantitative pcr instrument
1
RNA Isolation and RT-qPCR Analysis
2
Quantifying circRNF13 and miR-139-5p in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to commencing the study, total RNA was extracted from PANC-1 and MIA-PaCa-2 cells using the TRIzol® reagent (Vazyme Biotech Co., Ltd). The concentration and purity of RNA were then measured using NanoDrop 2000 equipment (Invitrogen, USA). Once the total RNA was extracted, we conducted RT-PCR using the PrimeScript RT Master Mix (Vazyme Biotech Co., Ltd) with corresponding primers to get the complementary DNA (cDNA) of target circRNAs and mRNAs. While the cDNA of target miRNAs was generated using the PrimeScript RT Reagent Kit (Vazyme Biotech Co., Ltd) with specific stem-loop primers. Then, the indicating cDNA was checked by qPCR using the Real-Time PCR Master Mix (SYBR Green; Vazyme Biotech Co., Ltd) in the CFX Connect Fluorescent Quantitative PCR Instrument (Bio-Rad, USA). Different primers were used in our study; U6 was used as the internal reference standard for miR-139-5p, and GAPDH was used as the internal reference standard for circRNF13 and IGF1R. All the primers used are listed below:
β-actin, forward: GTCTGCCTTGGTAGTGGATAATG and reverse: TCGAGGACGCCCTATCATGG
IGF1R, forward: TCGACATCCGCAACGACTATC and reverse: CCAGGGCGTAGTTGTAGAAGAG
CircRNF13, forward: CCTTATCATAGTGGGCATCTGTC and reverse: AGCATCTCGTTGTAAAATCACCTT
miR-139-5p, forward: ACACTCCAGCTGGGGACCTCTGTGCACGTG and reverse: TGGTGTCGTGGAGTCG
U6, forward: CTCGCTTCGGCAGCACA and reverse: AACGCTTCACGAATTTGCGT
3
Quantitative Analysis of circSEC24A, miR-606, and TGFBR2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol® reagent (No. R701-01, Vazyme Biotech Co., Ltd) in our study was used to isolate the total RNA from cultured cells or frozen tissues. The purity (OD260/280) and concentration of RNA was detected using NanoDrop 2000 instrument (Invitrogen, USA). For circRNA and mRNA, the complementary DNA (cDNA) was generated using the PrimeScript RT Master Mix (No. R323-01, Vazyme Biotech Co., Ltd) with random primers. For miRNA, the cDNA was generated using the PrimeScript RT Reagent Kit (No. MR101-01, Vazyme Biotech Co., Ltd) with specific stem-loop primers. Subsequently, the resulting cDNA was used for qPCR using the Realtime PCR Master Mix (No. Q711-02, SYBR Green, Vazyme Biotech Co., Ltd) in CFX Connect Fluorescent Quantitative PCR Instrument (Bio-Rad, USA). Various primers (RiboBio, Guangzhou, China) used for qPCR were listed below. circSEC24A F (forward): 5′-TTCAGCTGTCAACCAAGAAGGT-3′ and R (reverse): 5′-AAAGTTGTAGGCAGAGGTGGA-3′); miR-606 F: 5′-CGCGCGAAACTACTGAAAATC-3′ and R: 5′-AGTGCAGGGTCCGAGGTATT-3′; GAPDH F: 5′-GGAGCGAGATCCCTCCAAAAT-3′ and R: 5′-GGCTGTTGTCATACTTCTCATGG-3′; U6 F: 5′-CTGGCTTCGGCAGCACA-3′ and R: 5′-AACGCTTCACGAATTTGCGT-3′; TGFBR2 F: 5′-GTAGCTCTGATGAGTGCAATGAC-3′ and R: 5′-CAGATATGGCAACTCCCAGTG-3′. The reference standard for circSEC24A and TGFBR2 was GAPDH. Specially, the reference standard for miR-606 was U6.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!