Dna engine t100 thermal cycler

Partial regions of 18S rDNA were amplified using the following sets of primers: GF1 (5 ′ TCCGGTCGATCCTGCCGGA 3 ′) and G452R (5 ′ GCTGCTGGCACCAGACCTTG 3 ′). PCR was performed in a TM 100 (BioRad) thermal cycler. The reactions were conducted in a 50 μl reaction mixture containing 5.0 μl template DNA, 1.0 μl (1U/ μl) of Color Taq DNA Polymerase (EURx), 1 μl of dNTPs mix (10 mM), 0.5 μl of GF1 and G452R primer (20 mM), 5 μl of 10 × Polymerase buffer (pH 8.6, 25 mM MgCl₂) and 37.0 μl of MiliQ water. A negative control—nuclease free water was added to the PCR mix instead of the tested DNA. DNA amplification was performed using the DNA Engine T100 Thermal Cycler (BioRad) according to the following program: denaturation at 95°C for 1 min, followed by 34 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s and extension at 72°C for 30 s, with a final extension performed at 72°C for 3 min.

DNA was extracted individually from air dried dandelion and soil samples using a Stool DNA Purification Kit (EURx, Poland) according to the manufacturer’s protocol. The dried samples were rehydrated with MiliQ water and then the DNA was isolated according to the manufacturer’s protocol.
Helminth DNA (positive control samples) was isolated from adult worms (Toxocara cati, Toxocara canis, Echinococcus spp., Dipylidium caninum, Taenia spp., Fasciola hepatica) using a Blood and Tissue DNA isolation kit (Qiagen) according to the manufacturer’s protocol. DNA from the eggs of Trichuris vulpis (fox), Toxocara cati (cat), Toxocara canis (dog) and Oxyuridae sp. (turtle) was isolated using a Stool DNA Purification Kit (EURx, Poland). All DNA amplifications were performed using the DNA Engine T100 Thermal Cycler (BioRad). In some cases, nuclease-free water was added to the PCR mix instead of the tested DNA as a negative control. The PCR products were then visualized on a 1.2% agarose gel (Promega) stained with SimplySafe (EURx). Visualization was performed using ChemiDoc, MP Lab software (Imagine, BioRad).