siRNA targeting SPP1 (siSPP1) and a scrambled siRNA (siScramble) were synthesized by GenePharma (GenePharma, Shanghai, P.R. China) to decrease the expression of SPP1. The siScramble and siSPP1 were transfected to the HCC827AR and PC9AR cells by Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. After 48 h, the cells were collected for further experiments. To validate the interference efficiency, SPP1 expression was examined by real-time quantitative (qRT)-PCR.
Sispp1
Manufactured by GenePharma
Sourced in United States
The SiSPP1 is a laboratory equipment designed for DNA/RNA extraction and purification. It utilizes a silica-based membrane technology to efficiently capture and purify nucleic acids from a variety of sample types. The core function of the SiSPP1 is to provide a reliable and consistent method for isolating high-quality DNA or RNA for further analysis and experimentation.
Automatically generated - may contain errors
Lab products found in correlation
Si scramble, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Si scramble, by GenePharma (1 mentions)
Spc a1, by National Collection of Authenticated Cell Cultures (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Beas 2b, by National Collection of Authenticated Cell Cultures (1 mentions)
Ab8226, by Abcam (1 mentions)
2 protocols using sispp1
1
Targeting SPP1 Expression in NSCLC
2
Silencing SPP1 in LUAD cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LUAD cell lines (A549 and SPC-A1) and human bronchial epithelial cells (BEAS-2B) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were cultured in DMEM or RPMI-1640 medium (Hyclone, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA).
The small interfering RNA of SPP1 (siSPP1) and control RNA (si-Ctrl) were synthesized by GenePharma Inc. (Shanghai, China). Lipofectamine 3000 (Invitrogen, USA) was used to transiently transfect the siRNA into cells. The sequence of siSPP1#1 is UAUUUUGGCCUUUAUUCUGUU, siSPP1#2 is GAGAATTGCAGTGATTTGCTTTT, and siSPP1#3 is AGGAAAAGCAGCTTTACAAAA. After 48 hours of incubation, the interfering effect was confirmed by Western blotting. The following antibodies were used: anti-SPP1 (ab302942, 1:1000, Abcam, USA), β-actin (ab8226, 1:1000, Abcam, USA).
The small interfering RNA of SPP1 (siSPP1) and control RNA (si-Ctrl) were synthesized by GenePharma Inc. (Shanghai, China). Lipofectamine 3000 (Invitrogen, USA) was used to transiently transfect the siRNA into cells. The sequence of siSPP1#1 is UAUUUUGGCCUUUAUUCUGUU, siSPP1#2 is GAGAATTGCAGTGATTTGCTTTT, and siSPP1#3 is AGGAAAAGCAGCTTTACAAAA. After 48 hours of incubation, the interfering effect was confirmed by Western blotting. The following antibodies were used: anti-SPP1 (ab302942, 1:1000, Abcam, USA), β-actin (ab8226, 1:1000, Abcam, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!