5 bromocytidine

RNA oligonucleotides were synthesized using t-BDMS phosphoramidite chemistry (Beaucage and Caruthers, 1981 ) as described in Wilson et al. (Wilson et al., 2001 (link)), implemented on an Applied Biosystems 394DNA/RNA synthesizer. Oligoribonucleotides containing 5-bromocytidine (ChemGenes) were deprotected in a 25% ethanol/ammonia solution for 36 h at 20°C. All oligoribonucleotides were redissolved in 115 μL of anhydrous DMSO, 60 μl triethylamine (Aldrich) and 75 μL triethylamine trihydrofluoride (Aldrich) to remove t-BDMS groups, and agitated at 65°C in the dark for 2.5 h. After cooling on ice for 10 min, 250 μL RNA quenching buffer (Glen Research) was added to stop the reaction and the oligonucleotides were desalted using NAP-10 columns (GE Healthcare).
RNA was further purified by gel electrophoresis in polyacrylamide under denaturing conditions in the presence of 7 M urea. The full-length RNA product was visualized by UV shadowing. The band was excised and electroeluted using an Elutrap Electroelution System (GE Healthcare) into 45 mM Tris-borate (pH 8.5), 5 mM EDTA buffer for 8 h. at 200 V at 4°C. The RNA was precipitated with ethanol, washed once with 70 % ethanol and dissolved in double-distilled water.

RNA oligonucleotides were synthesized using solid-phase t-BDMS phosphoramidite chemistry (Beaucage and Caruthers 1981 (link)) as described in Wilson et al. (2001) (link), implemented on an Applied Biosystems 394DNA/RNA synthesizer. Oligonucleotides containing 5-bromocytidine (ChemGenes) were deprotected in a 25% ethanol/ammonia solution for 36 h at 20°C. The oligonucleotide containing 2-aminopurine (Glen Research) was deprotected in 1:1 ammonia/methylamine solution for 20 min at room temperature followed by 10 min at 65°C. All oligoribonucleotides were redissolved in 100 μL of anhydrous DMSO and 125 μL triethylamine trihydrofluoride (Aldrich) to remove t-BDMS groups, and agitated at 65°C in the dark for 2.5 h. After cooling on ice for 10 min, the RNA was precipitated with 1 mL of butanol, washed twice with 70% ethanol and suspended in double-distilled water.
RNA was purified by gel electrophoresis in polyacrylamide under denaturing conditions in the presence of 7 M urea. The full-length RNA product was visualized by UV shadowing. The band was excised and electroeluted using an Elutrap Electroelution System (GE Healthcare) into 45 mM Tris-borate (pH 8.5), 5 mM EDTA buffer for 8 h at 200 V at 4°C. The RNA was precipitated with ethanol, washed once with 70% ethanol, and suspended in double-distilled water.

RNA oligonucleotides were synthesized using t-BDMS phosphoramidite chemistry (Beaucage and Caruthers, 1981 ) as described in Wilson et al. (Wilson et al., 2001 (link)), implemented on an Applied Biosystems 394DNA/RNA synthesizer. Oligonucleotides containing 5-bromocytidine (ChemGenes) were deprotected in a 25% ethanol/ammonia solution for 36 h at 20°C. All oligoribonucleotides were redissolved in 100 μL of anhydrous DMSO and 125 μl triethylamine trihydrofluoride (Aldrich) to remove t-BDMS groups, and agitated at 65°C in the dark for 2.5 h. After cooling on ice for 10 min, the RNA was precipitated with 1 mL of butanol, washed twice with 70 % ethanol and suspended in double-distilled water.
RNA was further purified by gel electrophoresis in polyacrylamide under denaturing conditions in the presence of 7 M urea. The full-length RNA product was visualized by UV shadowing. The band was excised and electroeluted using an Elutrap Electroelution System (GE Healthcare) into 45 mM Tris-borate (pH 8.5), 5 mM EDTA buffer for 8 h. at 200 V at 4°C. The RNA was precipitated with ethanol, washed once with 70 % ethanol and suspended in double-distilled water. The RNA sequence used for crystallization was (5' to 3') :
C(BrC)GGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGG(BrC)GC where BrC is 5-bromocytosine.