Epityper assay

Manufactured by Labcorp

Sourced in United States

The EpiTYPER assay is a quantitative DNA methylation analysis platform developed by Labcorp. It utilizes matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry to measure DNA methylation levels at specific CpG sites within a genomic region of interest.

Automatically generated - may contain errors

Lab products found in correlation

25 protocols using epityper assay

Global and Gene-Specific DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following extraction, DNA was converted by bisulfite reaction using the EZ DNA Methylation-Gold kit (Zymo Research, Irvine, CA). Global DNA methylation was measured by ELISA with the 5-mC DNA ELISA kit (Zymo Research). Gene-specific DNA methylation was quantified by EpiTYPER assay (Sequenom, San Diego, CA), as previously described [35 (link)]. We chose to target regions identified as CpG islands, by the UCSC Genome Browser at http://genome.ucsc.edu/ [36 (link)], found in our genes of interest with bisulfite-specific primers (S2 Table) required for the assay.

Nguyen A., Duquette N., Mamarbachi M, & Thorin E. (2016). Epigenetic Regulatory Effect of Exercise on Glutathione Peroxidase 1 Expression in the Skeletal Muscle of Severely Dyslipidemic Mice. PLoS ONE, 11(3), e0151526.

+ Open protocol

+ Expand

DNA Methylation Analysis Using MassARRAY

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR products were treated according to the standard protocol (Sequenom EpiTyper Assay) by SAP treatment and T-cleavage reaction. The samples were then cleaned by Resin and were dispensed to a 384 SpectroCHIP by Nanodispenser. DNA methylation levels were determined as previously described [20 (link)] using MassARRAY EpiTYPER (SEQUENOM Inc., Herston, QLD, Australia) system, which is based on MALDI-TOF MS [21 (link)]. The mass spectrum was collected by MassARRAY Spectrometer and analyzed by EpiTYPER v.1.0 software (SEQUENOM).

Liang J., Kang X., Halifu Y., Zeng X., Jin T., Zhang M., Luo D., Ding Y., Zhou Y., Yakeya B., Abudu D, & Pu X. (2015). Secreted frizzled-related protein promotors are hypermethylated in cutaneous squamous carcinoma compared with normal epidermis. BMC Cancer, 15, 641.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EpiTYPER assay (Sequenom) was used to quantitatively analyze the DNA methylation state of PARP-1 and TET1 CGIs. 1 μg of DNA was bisulfite-converted using the EZ-96 DNA Methylation Kit (Zymo Research) with the following modifications: incubation in CT buffer was performed for 21 cycles of 15 min at 55°C and 30 sec at 95°C and elution of bisulfite-treated DNA was performed in 100 μl of water. PCR was performed on 10 ng of bisulfite-treated DNA using specific primers (reported in Supplementary Methods). The two TET1 amplicons mapped in regions chr10:70,320,085-70,320,271 and chr10:70,320,251-70,320,466 respectively, while PARP-1 amplicon mapped in chr1:226,595,508-226,596,006 region. After data cleaning, it was possible to measure the methylation state of 27 and 31 CpGs in TET1 and PARP-1 CGIs respectively.

Ciccarone F., Valentini E., Bacalini M.G., Zampieri M., Calabrese R., Guastafierro T., Mariano G., Reale A., Franceschi C, & Caiafa P. (2014). Poly(ADP-ribosyl)ation is involved in the epigenetic control of TET1 gene transcription. Oncotarget, 5(21), 10356-10367.

+ Open protocol

+ Expand

Bisulfite Conversion and MALDI-TOF MS for DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For bisulfite conversion, 500 ng of tissue genomic DNA or 5–100 ng cfDNA was converted using the EZ DNA Methylation-Gold™ kit (Zymo Research, Freiburg; Germany). Subsequent PCR amplification was performed using HotStarTaq Plus DNA Polymerase kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions incorporating the T7 promoter sequence as listed in Supplementary Table 1. PCR products were verified by electrophoresis with a 1% agarose gel. According to the instructions of Sequenom MassARRAY EpiTyper Assay the PCR products were subjected to alkaline phosphatase treatment followed by in vitro transcription and RNaseA cleavage to result in specific fragmentation. The obtained fragments were subjected to matrix-assisted laser desorption/ionization time-of-flight mass-spectrometry (MALDI-TOF MS). Results were exported from the MassARRAY instrument with EpiTyper v1.0 software. Unless otherwise stated, DNA methylation values were calculated as the average methylation of all CpG sites within each PCR product.

Gahlawat A.W., Witte T., Sinn P, & Schott S. (2023). Circulating cf-miRNA as a more appropriate surrogate liquid biopsy marker than cfDNA for ovarian cancer. Scientific Reports, 13, 5503.

+ Open protocol

+ Expand

Quantitative DNA Methylation Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EpiTYPER assay (Sequenom, San Diego, USA) [38 (link)] was used to quantitatively assess the DNA methylation of two subtelomeric regions located in the short arm of chromosome 5 (5p; chr5:12,038–12,237 in the GRCh37/hg19 assembly) and in the long arm of chromosome 21 (21q), respectively. DNA (1 μg) was bisulphite-converted using the EZ-96 DNA Methylation Kit (Zymo Research, Irvine, USA) with the following modifications: incubation in CT buffer for 21 cycles of 15 min at 55 °C and 30 s at 95 °C, elution of bisulphite-treated DNA in 100 μl of water. Bisulphite-specific primers were designed using the EpiDesigner software (https://www.epidesigner.com) and checked by SYBR Green-based melt curve to evaluate the specificity of the amplification. The selected primers amplified the following regions, annotated in the GRCh37/hg19 assembly: chr5:12,038–12,237 (5p Fw: aggaagagagTTTTTTTTATTATAGATGTTGGGGG; 5p Rv: cagtaatacgactcactatagggagaaggctCCCAAACCTTCCTTAAAAACATCT); chr21:48,081,403-48,081,721: 21q Fw: aggaagagagGTTTTGTTGTGGAAAGGTTTAGTT; 21q Rv: cagtaatacgactcactatagggagaaggctCCCTCAAAATCTAAATCAAACAAAT. PCR was performed on 10 ng of converted DNA.

Bacalini M.G., Reale A., Malavolta M., Ciccarone F., Moreno-Villanueva M., Dollé M.E., Jansen E., Grune T., Gonos E.S., Schön C., Bernhardt J., Grubeck-Loebenstein B., Sikora E., Toussaint O., Debacq-Chainiaux F., Capri M., Hervonen A., Hurme M., Slagboom P.E., Breusing N., Aversano V., Tagliatesta S., Franceschi C., Blasco M.A., Bürkle A., Caiafa P, & Zampieri M. (2021). Ageing affects subtelomeric DNA methylation in blood cells from a large European population enrolled in the MARK-AGE study. GeroScience, 43(3), 1283-1302.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis of rDNA Locus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative DNA methylation analysis of rDNA locus was performed using the EpiTYPER assay (Sequenom). Briefly, 1000 ng of DNA were bisulphite converted using the EZ-96 DNAMethylation Kit (Zymo Research Corporation) as previously described [21 (link)]. 10 ng of bisulphite-treated DNA were PCR-amplified using the following primers: Ribo forward: AGGAAGAGAGGTGTGTTTTGGGGTTGATTAGAG; Ribo reverse: CAGTAATACGACTCACTATAGGGAGAAGGCTAAAACCCAACCTCTCCAAC; 18S forward: AGGAAGAGAGGTTTGTTGTTTTTTTTGGATGTGG; 18S reverse: CAGTAATACGACTCACTATAGGGAGAAGGCTCCTTACCTACCTAATTAATCCTACCAA; 28S forward: AGGAAGAGAGGGTATTTAGTTTTAGATGGAGTTTATTATT; 28S reverse: CAGTAATACGACTCACTATAGGGAGAAGGCTAAAAAAAACTAACCAAAATTCCC. For each gene, CpG sites with missing values in more than 20% of the samples were removed, as well as samples with missing values in more than 20% of CpG sites.

Bacalini M.G., Pacilli A., Giuliani C., Penzo M., Treré D., Pirazzini C., Salvioli S., Franceschi C., Montanaro L, & Garagnani P. (2014). The nucleolar size is associated to the methylation status of ribosomal DNA in breast carcinomas. BMC Cancer, 14, 361.

+ Open protocol

+ Expand

Runx3 DNA Methylation Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The methylation levels of many CpG sites of Runx3 were quantified by Laser Matrix Support Release/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS) of the MassArray system (Sequenom EpiTYPER assay, San Diego, CA).^{17 (link)} In this process, bisulfite conversion of DNA was firstly performed using the EZ DNA Methylation kit (Zymo Research, CA) following the manufacturer's instructions. Secondly, PCR and in vitro transcription were carried out in DNA samples by bisulfite conversion. Thirdly, the target regions were amplified using the primer pairs (EpiDesigner software, www.epidesiger.com) including the forward primer (aggaagagagGTTTTTGGGGATGTAGGTTTGG) and reverse primer (cagtaatacgactcacta tagggagaaggctAAAAAACACTTCATAATAAACCACC), and then treated by Shrimp Alkaline Phosphatase (SEQUENOM, San Diego, CA). Fourthly, the products were used as the template for in vitro transcription and base-specific cleavage with RNase A. Lastly, all of the cleavage products were analyzed by MALDI-TOF-MS according to the manufacturer's instructions; 10% of the parallel samples were done in order to ensure the accuracy of the results.

Zhao C., Li P., Zhang L., Wang B., Xiao L., Guo F, & Wei Y. (2016). An Observational Study on Aberrant Methylation of Runx3 With the Prognosis in Chronic Atrophic Gastritis Patients. Medicine, 95(20), e3356.

+ Open protocol

+ Expand

Quantifying FKBP5 Intron 7 Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The methylation state of 5 CpG sites in the intron 7 of FKBP5 was measured by MALDI-TOF mass spectrometry using EpiTYPER by MassARRAY (Sequenom, San Diego, CA), as previously described^{53 (link)}. First, 500 ng DNA of each sample was bisulfite converted using the EZ-96 DNA Methylation Kit (Zymo Research, Orange, CA, USA). Primers were designed for one amplicon, covering 5 CpG sites, using the EpiDesigner (Sequenom, San Diego, CA) (Supplementary Table S11). The target region was subsequently amplified using bisulfide-specific primers followed by shrimp alkaline phosphatase (SAP) treatment, and RNAse A cleavage (known as T-cleavage) performed according to the standard protocol (Sequenom EpiTYPER Assay). The PCR product fragments were then cleaned by Resin and spotted on 384 SpectroCHIPs by Nanodispenser. The Chip was analysed by Sequenom Autoflex Mass Spectrometer, and data were extracted using SpectroACHIRE software, and massARRAY EpiTYPER v.1.2 software.

Hertel J., König J., Homuth G., Van der Auwera S., Wittfeld K., Pietzner M., Kacprowski T., Pfeiffer L., Kretschmer A., Waldenberger M., Kastenmüller G., Artati A., Suhre K., Adamski J., Langner S., Völker U., Völzke H., Nauck M., Friedrich N, & Grabe H.J. (2017). Evidence for Stress-like Alterations in the HPA-Axis in Women Taking Oral Contraceptives. Scientific Reports, 7, 14111.

+ Open protocol

+ Expand

Quantitative Methylation Analysis of OPRM1 Promoter

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative methylation analysis of the human OPRM1promoter was performed through the Genome Analysis Core Facility at UCSF, using
the EpiTYPER assay (Sequenom, San Diego, CA) in conjunction with the MassARRAY
(Sequenom) system, by a technician who was blinded to the treatment groups. The
target region in the human promoter spanned from −232 to +109
relative to the transcription start site. The target region on the mouse
promoter was −304 to +71 relative to the transcription start
site. Primers were designed using EpiDesigner (Sequenom) software.
At least 1 μg of DNA from each sample was treated with sodium
bisulfite, amplified with polymerase chain reaction, and excess dNTP
(deoxyribonucleotide triphosphate) was treated with shrimp alkaline phosphatase,
as described previously.^{33 (link)} The
samples were then spotted on a 384-pad Spectro-CHIP (Sequenom) and analyzed
using a MassARRAY analyzer compact MALDI-TOF MS (matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry). Methylation calls were
analyzed using EpiTyper software version 1.0 (Sequenom) to produce quantitative
results for each CpG unit, which consists of a single CpG
(5′-C-phosphate-G-3′) site or aggregate of adjacent CpG sites.
Fully methylated DNA was used as a positive control and water was used as a
negative control.

Viet C.T., Dang D., Aouizerat B.E., Miaskowski C., Ye Y., Viet D.T., Ono K, & Schmidt B.L. (2017). OPRM1 Methylation Contributes to Opioid Tolerance in Cancer Patients. The journal of pain : official journal of the American Pain Society, 18(9), 1046-1059.

+ Open protocol

+ Expand

Quantitative DNA Methylation Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EpiTYPER assay (Sequenom) was used to quantitatively assess the DNA methylation state of TET1 and TDG CGIs and TET1 3′-shore. DNA (1 μg) was bisulfite-converted using the EZ-96 DNA Methylation Kit (Zymo Research) with the following modifications: Incubation in CT buffer was performed for 21 cycles of 15 min at 55°C and 30 sec at 95°C and elution of bisulfite-treated DNA was performed in 100 μl of water. PCR was performed on 10 ng of bisulfite-treated DNA using specific primers. The TET1 CGIs and TET1 3′-shore amplicons mapped in chr10:70,320,251-70,320,466 and chr10:70,321,719-70,322,204 (GRCh37/hg19) regions, respectively. TDG amplicon mapped in chr12:104,359,220-104,359,701 (GRCh37/hg19) region.
Bisulfite specific primers were the following:
TDG_Forward: aggaagagagGGTTGGTAGTATTTAGATAGTGGTTGGTDG_Reverse:
cagtaatacgactcactatagggagaaggctAAAACCCAAAATAACACAATAACCTC
TET1 CGI_Forward:
aggaagagagGGTTTTTAGTTTTAAGTTTGTATTAGTTTTTET1 CGI_Reverse:
cagtaatacgactcactataGGGAGAAGGCTATCATACAACCCTACCTACCTCTCC
TET1 3′shore_Forward:
aggaagagagTTTAAGTTTTTTGATTTTTGGTTTGTET1 3′shore_Reverse:
cagtaatacgactcactatagggagaaggctCTCTTAAAATACCTCTTCCCCTCC

Valentini E., Zampieri M., Malavolta M., Bacalini M.G., Calabrese R., Guastafierro T., Reale A., Franceschi C., Hervonen A., Koller B., Bernhardt J., Slagboom P.E., Toussaint O., Sikora E., Gonos E.S., Breusing N., Grune T., Jansen E., Dollé M.E., Moreno-Villanueva M., Sindlinger T., Bürkle A., Ciccarone F, & Caiafa P. (2016). Analysis of the machinery and intermediates of the 5hmC-mediated DNA demethylation pathway in aging on samples from the MARK-AGE Study. Aging (Albany NY), 8(9), 1896-1915.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!