Ab108248

Cd39 mRNA expression was detected in both LPS-treated and untreated BMDCs. Collected BMDCs were seeded in six-well plates and treated with LPS at 50 ng/ml for 48 h or left untreated, and then the cells were collected for qPCR and western blotting assays. For the qPCR assay, total RNA was extracted from cells and reverse transcribed into cDNA. cDNA (1.0 μg) was subjected to SYBR Green qPCR for Entpd1 on an iQ5TM (Bio-Rad), and Gapdh was used as a reference gene. The primers used were as follows: Cd39 (NM_009848.4) forward, 5′-TTATGGGCAAGATCAAAGACAG−3′ and reverse, 5′- GCAGGGAGAAGAGAACCATG−3′; and Gapdh (NM_001289726.1) forward, 5′- TGCTGAGTATGTCGTGGAG−3′ and reverse, 5′- TGTCATATTTCTCGTGGTTC−3′. The relative Cd39 transcript level was calculated with the 2^−ΔΔCT method. To evaluate membrane-localized CD39 by western blotting, protein from the cell membrane was isolated with a membrane protein extraction kit (ThermoFisher Scientific) according to the manufacturer's protocol. An aliquot of the isolated membrane protein was subjected to western blotting for CD39 (#ab108248, Abcam) with Na⁺/K⁺ ATPase used as a reference (#58475, Abcam).

Macrophage lysates were prepared in lysis buffer (0.1% SDS, 25 mmol/L Tris-HCl pH 7.4, and protease inhibitors) and 40 μg of protein was separated by SDS-PAGE and blotted to polyvinylidenedifluoride membrane. Rabbit monoclonal anti-eNTPD1 (1/5000, ab108248, Abcam, Cambridge, United Kindom) and rabbit polyclonal anti-TNAP (1μg/mL, ab65834, Abcam) were used according to manufacturers’ instructions and as described[26 (link)].

The frozen tPVAT, sWAT, and iBAT tissues were lysed in RIPA buffer (Merck Millipore, 20-188) containing 1% protease inhibitor cocktail (Biotool, B14002). The protein extractions were collected for western blot as previously described (Harms et al., 2014 (link)). The primary antibodies were as follows: anti-UCP1 (1:1000 dilution) (Abcam, ab23841), anti-peroxisome proliferator-activated receptor-γ (PPARγ, 1:1000 dilution) (Santa Cruz, sc-7273), anti-PPARγ-coactivator 1-α (PGC1α, 1:1000 dilution) (Santa Cruz, sc-13067), anti-CD73 (1:1000 dilution) (Abcam, ab108248), and GAPDH monoclonal antibody (1:4000 dilution) (Proteintech, HRP-6004). Immunoreactive bands were highlighted by electrochemiluminescence (ECL) technology and quantified using imaging software Quantity One (Bio-Rad Laboratory, Spain).