We cloned the cDNA fragments of Hvdyl and an enhanced green fluorescent protein (egfp). Hvdyl and egfp were amplified with PCR using specific primers (Table S1 ) conjugated with the T7 RNA polymerase promoter. Two independent dsHvdyl primers were designed (dsHvdyl-F1R1, dsHvdyl-F2R2) (Table S1 , Figure S1 ). Due to the consistent RNAi phenotypes observed with both sets of primers, the results based on primary primers (dsHvdyl-F1R1) are presented in this article (Figure S2 ). In order to verify whether there are any possible off-target sequences that possess an identical match of 20 bp or more, we used BLAST to search these two targeted regions against the H. vigintioctopunctata transcriptome. The dsRNAs (dsdyl, dsegfp) were synthesized using the MEGAscript T7 High Yield Transcription Kit (Ambion, Austin, TX, USA) in accordance with a previously described protocol [16 (link)]. The quality of the dsRNA was evaluated via agarose gel electrophoresis, and the concentration was quantified with a Nanodrop 1000 spectrophotometer.
Megascript t7 high yield transcription kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada, China
The MEGAscript T7 High Yield Transcription Kit is a laboratory product designed for the in vitro synthesis of large quantities of RNA. It utilizes the T7 RNA polymerase system to efficiently transcribe DNA templates and generate high yields of RNA for various applications.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Nanoject 2 microinjector, by Drummond (3 mentions)
5xall in one mastermix with accurt genomic dna removal kit, by Applied Biological Materials (3 mentions)
Cellfectin 2 reagent, by Thermo Fisher Scientific (2 mentions)
Las 100 detector, by Fujifilm (2 mentions)
Imagen reader las 1000, by Fujifilm (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Mp 255 micromanipulator, by Sutter Instruments (2 mentions)
Pli 100 pico injector, by Harvard Apparatus (2 mentions)
Mmessage mmachine mrna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Dynabeads m 280 streptavidin, by Thermo Fisher Scientific (2 mentions)
Hotstartaq master mix kit, by Qiagen (2 mentions)
Qiaspin miniprep kit, by Qiagen (2 mentions)
Cyanine5 maleimide, by Lumiprobe (2 mentions)
Femtojet microinjector, by Eppendorf (1 mentions)
Attractene transfection reagent, by Qiagen (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Xbali, by New England Biolabs (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
58 protocols using megascript t7 high yield transcription kit
1
Cloning and RNAi of Hvdyl and eGFP
2
dsRNA Synthesis and RNAi Bioassay for Insect Pests
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The dsRNA synthesis and RNAi bioassay method were applied, as previously described (Li et al., 2018 (link)). The dsDNA fragments were amplified by RT-PCR using specific primers (Supplementary Table S1 ) and used as templates to synthesize dsRNA using the MEGAscript T7 High-Yield Transcription Kit (Ambion, Austin, TX, United States). The quality and concentration of the dsRNA were detected and kept at −80°C until further use. The dsRNA targeting the gene-encoding green fluorescence protein (dsGFP) served as a negative control.
RNA interference (RNAi) was performed by the FemtoJet microinjector (Eppendorf), as previously reported (Wang et al., 2018 (link)). Approximately 200 ng and 400 ng dsRNA were microinjected into each individual of the third and fifth instar nymphs, respectively (Xu et al., 2015 (link)). A total of 250 nymphs (10 replicates) were used for each treatment, including three survival evaluation replicates, three phenotypic evaluation replicates, three qRT-PCR verification replicates, and one backup replicate. QRT-PCR verification was conducted 3 days after injection.
RNA interference (RNAi) was performed by the FemtoJet microinjector (Eppendorf), as previously reported (Wang et al., 2018 (link)). Approximately 200 ng and 400 ng dsRNA were microinjected into each individual of the third and fifth instar nymphs, respectively (Xu et al., 2015 (link)). A total of 250 nymphs (10 replicates) were used for each treatment, including three survival evaluation replicates, three phenotypic evaluation replicates, three qRT-PCR verification replicates, and one backup replicate. QRT-PCR verification was conducted 3 days after injection.
3
Nlug-desatA2 Gene Silencing in BPH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 287 bp fragment of Nlug-desatA2 (GenBank accession number: MH271234) and an 860 bp fragment of control gene GFP were amplified by RT-PCR with primers, including a T7 promoter sequence (Table S1 ). The dsRNAs were synthesized with PCR products by using a MEGAscript T7 High-Yield Transcription Kit (Ambion, Austin, TX, USA). Third- or fifth-instar nymphs were injected as described in Reference [55 (link)], with 0.25 µg dsRNA of Nlug-desatA2 or GFP, and controls were not injected (C-BPH). The silencing efficiency of Nlug-desatA2 in the whole bodies of BPH adults was investigated on 1 and 3 days post-adult emergence (5 and 7 days post-injection if nymphs were injected at the third instar, or 2 and 4 days post-injection if nymphs were injected at the fifth instar. RNA was extracted from 15 female individuals).
4
Ecdysone-induced Psq protein analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Kc167 cells (DGRC cat. no. 1) were maintained in SFX medium supplemented with 10% inactivated fetal bovine serum (Invitrogen, ref. #10108-165) and penicillin/streptomycin stock of antibiotics (Sigma P4333-100ML) at 25°C without CO2. Ecdysone treatment was done by incubation with 0.5 μM 20-Hidroxyecdysone (20-HE) (Sigma H5142-10MG) in culture medium for 3 hr; vehicle control with ethanol was performed in parallel. Western analysis was performed using standard procedures. PVDF membranes were incubated with one of the following primary antibodies: polyclonal rabbit a-Psqtot (1:2000), polyclonal rabbit a-PsqL (1:2000), a-Actin (Sigma A2066, 1:500), rat a-Mod(mdg4)2.2 (1:2000), rabbit a-CP190 (1:2000). Proteins were detected using the chemiluminescent substrate ECL (Pierce, 32209), LAS-100 detector (FujiFilm) and Imagen Reader LAS-1000 software (FujiFilm). Transient transfection experiments were done in 6 well plates with 8 × 105 cells per well in 2 mL of medium and 1 μg of total DNA per well. The amount of each plasmid was adjusted to obtain equimolar concentrations. Cells were transfected using Cellfectin II Reagent (Invitrogen 10362-100). dsRNA was generated using the Megascript T7 High Yield Transcription Kit (Ambion NC. 1404051). Primers used for the RNAi KD recognizing all isoforms of Psq are For 5′-TAATACGACTCACGCTGCCCTGCTTA-3′; Rev 5′- TAATACGACTCACAAGGCTCA CAATG-3′).
5
dsRNA Knockdown and DENV-2 Binding Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Double-stranded RNA (dsRNA) was synthesized from PCR-amplified gene fragments using the MEGAscript T7 High Yield Transcription Kit (Ambion). The sequences of the primers are listed in Supplementary Table S2 . Transfection of dsRNA was carried out using Attractene Transfection Reagent (Qiagen) according to the manufacturer’s instruction. Briefly, cells were seeded in the 48-well plate for 24 h prior to transfection. One microgram of dsRNA was incubated with 3.5 μl Attractene Transfection Reagent in 50 μl Schneider’s Drosophila Medium for 10–15 min at room temperature and then transferred to each well. Three days post-transfection, DENV-2 binding assays were then performed at 4°C on R-Aag-2 and W-Aag-2 cells with an MOI of 10. Gene silencing efficiency was determined by comparing the relative mRNA levels of the target gene after knockdown with its specific dsRNA and dsRNA of green fluorescent protein (dsGFP, the non-target control) using real-time PCR.
6
EV71 Subgenomic Replicon Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA transcripts and the EV71 subgenomic replicon were obtained by using the MEGA script T7 High Yield Transcription kit (Ambion), and the DNA that was linearized by SalI or XbalI (NEB) digestion was used as a template according to the manufacturer's protocol. In vitro transcribed RNA was transfected into RD cell monolayers in 100 mm × 20 mm dishes with Lipofectamine 2000 (Invitrogen), and the cells were then incubated at 37°C in 10 ml DMEM containing 10% FBS per dish. The cytopathic effects (CPE) of RD cells were observed at 24 h post transfection. When 90% of the cells exhibited CPE, the cell supernatants were then collected by centrifugation at 4,000 rpm for 5 min, and the target viruses were stored at -80°C.
7
Generating CRISPR sgRNA Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sgRNAs were designed using CHOPCHOP (http://chopchop.cbu.uib.no ) based on the principle of GG (20 N) GG or CC (20 N) CC, where N is any nucleotide, and simultaneously evaluated for efficiency and potential off-target effects. Finally, four sgRNAs were selected in Tacinnabar exon 3 (Table 2 ).
Synthetic sgRNA templates were generated using PCR and specific primers (Table 1 ), verified using agarose gel electrophoresis, and purified using the AxyPrep DNA Gel Extraction Kit. The templates were then transcribed in vitro using the MEGA script T7 High Yield Transcription Kit (Ambion, Austin, TX, United States), following the manufacturer’s instructions, and the synthesised sgRNAs were extracted using phenol/chloroform/isoamyl alcohol, diluted in RNase-free water, and stored at −80°C until further use.
Synthetic sgRNA templates were generated using PCR and specific primers (
8
RNAi Knockdown of LK and LKR in Hyphantria cunea
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 463-bp dsRNA representing the H. cunea LK-encoding gene sequence and a 505-bp dsRNA representing the H. cunea LKR-encoding gene sequence were synthesized using the MEGAscript T7 high-yield transcription kit (Ambion) according to the manufacturers’ protocol. The dsRNA was purified with phenol/chloroform followed by ethanol precipitation. The dsRNA of the enhanced green fluorescent protein gene (pEGFP-N1 plasmid as template, WP_031943942.1, 507-bp dsRNA) was employed as a control. A 2μg/μl dsRNA solution (1μl) was microinjected into the penultimate posterior abdominal section of individual seventh instar H. cunea larvae using an injection needle (MICROLITERTM #65 with 33-gauge needle, Hamilton Co., Reno, NV, United States) under ice anesthesia (Sun et al., 2016 (link)). Control H. cunea larvae were microinjected with the EGFP dsRNA. Microinjected H. cunea larvae were allowed to recover for 2h at room temperature and then reared on an artificial diet under a 16:8h light: dark photoperiod at 25±1°C. After 72 and 96h, LK and LKR mRNA levels in the dsRNA-treated seventh instar H. cunea larvae were measured by qRT-PCR technology.
9
In vitro Transcription of Long RNAs
10
Efficient siRNA Design and Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A highly efficient and specific siRNA fragment originated from EcR or usp was selected using the siRNA online design website (http://sidirect2.rnai.jp/ (accessed on 15 June 2022)). Then, a pair of primers was designed using the software primer premier 5.0 (Table S1 ) to amplify a cDNA including the siRNA fragment. The targeted cDNA sequence was further BLASTN searched against transcriptome data to identify any possible off-target sequences that had an identical match of 20 bp or more. Moreover, a cDNA fragment was derived from enhanced green fluorescent protein (egfp) in Aequorea victoria. These fragments were respectively amplified by PCR using specific primers (Table S1 ) conjugated with the T7 RNA polymerase promoter. The dsRNAs were synthesized using the MEGAscript T7 High Yield Transcription Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Subsequently, the synthesized dsRNA (at a concentration of 5–8 μg/μL) was determined by agarose gel electrophoresis and the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, New York, NY, USA) and kept at −80 °C until use.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!