DON (CAS No. D0156-5MG) was procured from Sigma (Sigma Chemical Co. St. Louis, MO, USA). Porcine IPEC-J2 cells were obtained from a cell bank in Wuhan academy of agricultural sciences, Wuhan, China. RPMI 1640, SuperScript III kit and Sybr qPCR mix were bought from Thermo Fisher Scientific, Waltham, MA, USA. Fetal bovine serum (FBS) was procured from Clark Bioscience, Richmond, VA, USA. NF-κB inhibitor (Pyrrolidine dithiocarbamate, PDTC) was procured from Beyotime Biotechnology, Shanghai, China. Cell counting kit-8 (CCK-8) kits were obtained from Dojindo Laboratories, Tokyo, Japan. The ELISA kit was bought from Senbeijia Biological Technology, Nanjing, China. BSA was bought from biosharp Company, Beijing, China. The primary NF-κB p65 polyclonal antibody (Product number: 10745-1-AP) was obtained from Proteintech Group, Inc, Rosemont, IL, USA. FITC-goat anti-rabbit IgG antibody (Product number: BA1105) was purchased from Boster Company, Wuhan, China. Trizol reagent was purchased from Invitrogen Biotechnology Co., Ltd., Shanghai, China.
Sybr qpcr mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR qPCR Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and necessary buffers and additives.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 rt kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 rt reagent kit, by Thermo Fisher Scientific (2 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Clark Bioscience (1 mentions)
Cell counting kit 8 cck 8 kit, by Dojindo Laboratories (1 mentions)
Protein assay kit, by Beyotime (1 mentions)
Diaminobenzidine dab, by Zhongshan Jinqiao Biotechnology (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt kit, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5, by Thermo Fisher Scientific (1 mentions)
Reverse transcriptase kit, by Vazyme (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Veriti thermal cycler, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
M mlv, by Promega (1 mentions)
26 protocols using sybr qpcr mix
1
Investigating NF-κB Regulation in IPEC-J2 Cells
2
Quantitative Assessment of Tight Junction Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the chemicals used in this study were of the highest grade and purity. DON standard was purchased from Sigma Chemical Co. (CAS No. D0156-5MG; St. Louis, MO, USA). TRIzol reagent was obtained from Invitrogen Biotechnology Co., Ltd. (Shanghai, China). The SuperScript III kit and SYBR qPCR mix were obtained from Thermo Fisher Scientific (Waltham, MA, USA). The primary antibody for ZO-1 was purchased from Abcam (Cambridge, MA, USA). The protein assay kit was purchased from Beyotime Institute of Biotechnology (Nanjing, China). The polyclonal antibody for NF-κB p65 was purchased from Proteintech (Rosemont, Chicago, IL, USA). The monoclonal antibody for IκB-α was obtained from Bio-Techne China Co., Ltd. (Minneapolis, MN, USA). Monoclonal antibodies against p-NF-κB p65, p-IκB-α, and COX-2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The β-actin antibody was obtained from Beijing Ray Antibody Biotech (Beijing, China). Diaminobenzidine (DAB) was obtained from Beijing Zhongshan Jinqiao Biotechnology (Beijing, China).
3
Real-Time PCR Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BMDMs or homogenized lung tissues using TRIzol reagent (Invitrogen) and reverse-transcribed to cDNA using a ReverTra Ace qPCR RT kit. The StepOnePlus System (Thermo Fisher Scientific, Waltham, MA, USA) was used for real-time PCR with THUNDERBIRD SYBR qPCR mix for the quantification of the cDNA. The following gene-specific primers were used: NGAL, forward 5′-CTCAGAACTTGATCCCT-GCC-3′ and reverse 5′-TCCTTGAGGCCCAGAGACTT-3′; KIM-1, forward 5′-TGCTG-CTACTGCTCCTTGTG-3′ and reverse 5′-GGGCCACTGG TACTCATTCT-3′; IL-6, forward 5′-CCACCAAGAACGATAGTCAA-3′ and reverse 5′-TTTCCACGATTTCCC-AGA-3′; TNF-α, forward 5′-TTCTCATTCCTGCTTGTGG-3′ and reverse 5′-ACTTGGT-GGTTTGCTACG-3′; IL-1β, forward 5′-CCAGCTTCAAATC TCACAGCAG-3′ and reverse 5′-CTTCTTTGGGTATTGCTTGGGATC-3′; GAPDH, forward 5′-TGCGACTT-CAACAGCAACTC-3′ and reverse 5′-CTTGCTCAGTGTCCT TGCTG-3′.
4
Kidney Immune Cell RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative polymerase chain reaction (RT-qPCR) was conducted according to the previous protocol [23 (link)]. Kidney immune cells were extracted according to the previous method. RNA from renal immune cells was extracted separately using Trizol (Invitrogen, USA) reagent by the manufacturer's instructions and then transcribed into cDNA using a reverse transcriptase kit (Vazyme, R333-01). RT-qPCR was conducted using SYBR qPCR Mix as a fluorescent dye on QuantStudio 5 (Thermo Fisher Scientific). The primers involved in the current study were obtained from Metabion (Martinsried, Germany) and were listed as follows, IL-1β (5′-TGGAGAGTGTGGATCCCAAG-3′ and 3′-GGTGCTGATGTACCAGTTGG-5′), TNF-α (5′-AACTAGTGGTGCCAGCCGAT-3′ and 3′-CTTCACAGAGCAATGACTCC-5′), TGF-β1 (5′-ACCGCAACAACGCCATCTATGAG-3′ and 3′-GGCACTGCTTCCCGAATGTCTG-5′), HMGB1 (5′-GCTGACAAGGCTCGTTATGAA-3′ and 3′-ATGGCGGGGTTTTAGTTTCC-5′), and β-actin (5′-GGCTGTATTCCCCTCCATCG-3′ and 3′-CCAGTTGGTAAC AATGCCATGT-5′).
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent and reverse-transcribed into complementary DNA. For conventional reverse transcription (RT)-PCR, specific transcript sequences were amplified using Applied Biosystems Veriti Thermal Cycler (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The quantitative RT-PCR (qRT-PCR) was performed in triplicate using the SYBR qPCR Mix with QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as internal reference. Relative quantification for qRT-PCR was calculated using the 2−ΔΔCT method. The primer sequences are summarized in online supplementary table S2 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen, 15596018), and cDNA was synthesized with a reverse transcription kit (Thermo Fisher Scientific, K1691). Real-time PCR was performed in duplicate using URAT1, GLUT9 and U6 primers with SYBR qPCR mix (Thermo Fisher Scientific, 4385612) according to the manufacturer’s protocol.
7
Quantifying miRNA-183 Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from exponentially growing cells by TRIzol reagent (Invitrogen, USA). Purified RNA was reverse transcribed into cDNA using M-MLV (Promega, USA). qRT-PCR was performed on an Applied Biosystems vii7 system using SYBR qPCR mix and has-miRNA-183 qPCR kit (Thermo Fisher). The primers were synthesized as follows: Erbin, 5′-ATCTCACCAAACGACCGACT-3′ and 5′-TCCTGGCATCATTGGAGGAG-3′; GAPDH, 5′-CACCATCTTCCAGGAGCGAG-3′ and 5′-AAATGAGCCCCAGCCTTCTC-3′. The relative expression of the target gene was calculated using the 2−ΔΔCt method. All experiments were performed in triplicate.
8
Traditional Chinese Medicine Enema for Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huayu Sanjie Enema Liquid was purchased from Qinghai Ruicheng Pharmaceutical Co., Ltd. (Shanghai, China). It consists of Angelica sinensis, Rhizoma Chuanxiong, Radix Paeoniae Rubra, Radix Rehmanniae, Semen Persicae, Flos Carthami, Radix Achyranthis Bidentatae, Sparganii Rhizoma, Rhizoma Curcumae, Radix Salviae Miltiorrhizae, Turtlenail, Amydae carapax, Akebia stem, Forsythiae, and Flos Lonicerae.Indomethacin capsules were purchased from Hebei Yongfeng Pharmaceutical Co., Ltd. (Shijiazhuang, China). The dosage for Sprague Dawley (SD) rats was converted according to the equivalent dose coefficient conversion algorithm.
Rat PGE2, IL-6, TNF-α, MIP-2, PAI-1, and TGF-β ELISA kits were purchased from the Nanjing Jiancheng Institute of Bioengineering (Nanjing, China). Rabbit anti-TRPV1 antibody and rabbit anti-TNF-α antibody were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China). Protein extracts and protease inhibitors were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China). The SuperScript III Reverse Transcription kit and SYBR qPCR mix were purchased from Thermo Fisher Scientific Co., Ltd. (Shanghai, China).
Rat PGE2, IL-6, TNF-α, MIP-2, PAI-1, and TGF-β ELISA kits were purchased from the Nanjing Jiancheng Institute of Bioengineering (Nanjing, China). Rabbit anti-TRPV1 antibody and rabbit anti-TNF-α antibody were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China). Protein extracts and protease inhibitors were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China). The SuperScript III Reverse Transcription kit and SYBR qPCR mix were purchased from Thermo Fisher Scientific Co., Ltd. (Shanghai, China).
9
Investigating Oxidative Stress in Y79 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Y79 cells [American Type Culture Collection (ATCC) (Manassas)], Rapamycin (Pfizer), enzyme-linked immunosorbent assay (ELISA) kits of reactive oxygen species (ROS) and malon- dialdehyde (MDA) (Nanjing Jiancheng Bioengineering Institute), radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime), loading buffer, protease inhibitor and bicinchoninic acid (BCA) protein concentration assay kit (Biosharp), glyceraldheyde 3-phosphate dehydrogenase (GAPDH) and secondary antibodies (ImmunoWay), primary antibodies (Cell Signaling Technology, Inc.), TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), diethyl pyrocarbonate (DEPC)-treated water, SuperScript III RT kit and SYBR qPCR Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.), electrophoresis apparatus (Bio-Rad Laboratories, Inc.), microplate reader (Thermo Fisher Scientific, Inc.), 2500 gel imager (Bio-Rad Laboratories, Inc.) and quantitative polymerase chain reaction (qPCR) instrument (7900 Fast, Applied Biosystems; Thermo Fisher Scientific, Inc.).
10
RT-qPCR Analysis of DNA Repair Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from total RNA extracted using RNeasy Mini Kit (Qiagen) (1 µg) by reverse transcription using Super-Script TM First strand synthesis for RT-PCR (Invitrogen, Carlsbad, CA) and random primers. RT-qPCR was performed with SYBR qPCR Mix and analyzed on an ABI Prism 7000 (Applied Biosystems, Carlsbad, CA). mRNA expression of the indicated genes were normalized with mRNA expression of the HPRT housekeeping gene. For the analysis of DHFR and GAPDH mRNA expression, data were normalized to the 18S RNA levels. Primers used were AAAGTGTCCGAGGGAATCGA and GGGACGCCAAACATGATGA for XPD, GAACCACTTTGATTTGCCAACTT and TTGCCTCTGTTTTGGTTATAAGCTT for XPA, GGACTAATTATGGACAGGACTG and TCCAGCAGGTCAGCAAAGAA for HPRT, TGCCACCAACTATCCAGACCA and CCTGGTTCTCCATTCCTGAGA for DHFR, CGACCACTTTGTCAAGCTCA and TACTCCTTGGAGGCCATGTG for GAPDH, and ATTCGAACGTCTGCCCTATCA and GTCACCCGTGGTCACCATG for 18S.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!