Jetseq library quantification lo rox kit

The following procedure was done according to Tallei et al. [16 (link)]. An Illumina two-step PCR protocol was used for preparing the amplicons library. The first stage was to generate PCR products of V3-V4 regions using Nextera-style tag sequences (overhang sequences) with the following sequences: forward overhang P5-tag: 5′TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG-[locus-specific sequence] and reverse overhang P7-tag: 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence]. The second stage used sample-specific Illumina Nextera XT dual indices (Nextera XT i7 index and Nextera XT i5 index) with the following sequences: P5-PCR index primer: 5′AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and P7-PCR index primer:5′CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGC TCGG. The final products were assessed using TapeStation 4200 from Agilent Technologies, HelixyteTM green dsDNA quantifying reagent, and qPCR using Jetseq library quantification Lo-Rox kit from Bioline (London, UK). The paired-end sequences were generated in a 2 × 300 bp format from MiSeq.

Bacterial cryo-cultures of the different isolates were revived on LB agar plates. Single colonies were picked and grown overnight in 2 ml LB medium at 37°C. The cells were pelleted by centrifugation. Cells were lysed and genomic DNA was extracted using a Nucleospin Tissue Kit (Machery and Nagel). Approximately 150–1,000 ng of DNA were used for fragmentation (insert size: 300–700 bp) and sequencing libraries were prepared following the NEB Ultra II FS Kit protocol (New England Biolabs). Libraries were quantified using a JetSeq Library Quantification Lo-ROX Kit (Bioline) and quality-checked by Bioanalyzer (Agilent). These libraries were sequenced on an Illumina MiSeq instrument with a final concentration of 8 pm using the v3 600 cycles chemistry and 5% PhiX.