Primescript rt kit

Total RNA was collected from tumour cells using TRIzol Reagent (cat. no. R1021; Beijing Transgen Biotech Co., Ltd., Beijing, China) and reversely transcribed into cDNA using the PrimeScript™ RT Kit (cat. no. RR014A; Takara Biotechnology Co., Ltd.) according to the instructions provided by the manufacturers. RT-qPCR was conducted thrice on an ABI 7500HT Real-Time PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the instructions provided by the manufacturer. The thermocycling conditions were as follows: initial denaturing step (94 °C, 10 min), followed by 40 cycles of denaturing (94 °C, 5 s), annealing (60 °C, 30 s) and extending (72 °C, 45 s). The primers sequences used are presented in Table 3. To verify the expression of UBE2T, endogenous mRNA was synthesised using a SYBR Green PCR Master Mix Kit (cat. no. 4309155; Invitrogen; Thermo Fisher Scientific, Inc.).Table 3

Primers for RT-qPCR for UBE2T and GAPDH

Gene	Forward primer (5'-3')	Reverse primer (5'-3')
UBE2T	CGAGCTCGTAGAAATATTAGGTGGA	TCATCAGGGTTGGGTTCTGA
GAPDH	AAGAAGGTGGTGAAGCAGGC	GTCAAAGGTGGAGGAGTGGG

UBE2T Ubiquitin-conjugating enzyme E2T, GAPDH Glyceraldehyde-3-phosphate dehydrogenase

The quantitative polymerase chain reaction (qPCR) method was used to detect the mRNA expression level of related genes as previously described (18 (link)). Briefly, the livers of zebrafish infected with A. hydrophila were extracted after intraperitoneal injection of bacterial strains for 3 days. Total RNA from zebrafish liver was extracted by the Trizol-chloroform (TaKaRa Inc., Japan) method. The total RNA was then reverse transcribed into cDNA following the instructions in the Prime Script RT Kit (TransGen Biotech Co., Ltd., Beijing, China). Finally, a real-time PCR detection system (Bio-Rad Inc., CA, USA) was used to detect the expression of related genes by real-time qPCR, and 16S rRNA was used as the internal reference gene. The primers used are shown in Supplementary Table S1.

Total RNA was extracted from brain tissue and bEnd.3 cells using Trizol reagent (Invitrogen, United States). Next, 1 µg mRNA was reverse transcribed into cDNA using the PrimeScriptTM RT kit (TransGen, China). SYBR Green PCR Master Mix (Applied Biosystems, United States) was used for real-time quantitative PCR on an ABI 7500 FAST real-time PCR System (Applied Biosystems, United States). The primers were listed as follows:Cox7c-F:5′-ATGTTGGGCCAGAGTATCCG-3′,Cox7c-R:5′-ACCCAGATCCAAAGTACACGG-3′; VEGFA-F:5′-GCACATAGAGAGAATGAGCTTCC-3′, VEGFA-R: 5′- CTC​CGC​TCT​GAA​CAA​GGC​T-3′; VEGFB-F: 5′- GCC​AGA​CAG​GGT​TGC​CAT​AC -3′, VEGFB-R:5′-GGAGTGGGATGGATGATGTCAG -3′; β-actin-F: 5′- GGC​TGT​ATT​CCC​CTC​CAT​CG-3′, β-actin-R: 5′- CCA​GTT​GGT​AAC​AAT​GCC​ATG​T-3′. Target gene expression levels were determined relative to the β-actin expression level using the ΔΔCT method.

To analyze the relative expression patterns of PvWOX3a in switchgrass, total RNA was extracted from E4I2 (Internode 2 at the E4 stage), E4L2 (Leaf 2 at the E4 stage), E3I2, E3L2, inflorescence, and crown bud tissues using a TRIzol Kit (TransGen Biotech, Beijing, China), and reverse transcribed into cDNA with a PrimeScript^TM RT Kit (TransGen Biotech, Beijing, China) after treatment with gDNA Eraser (Takara, Dalian, China). SYBR Premix ExTaq^TM (Takara, Dalian, China) was used for qRT–PCR, and the cycle thresholds were determined using a Roche LightCycler^® 480 II sequence detection system (Roche, Shanghai, China). The data were normalized to the level of PvUbq2 transcripts (GenBank accession NO: HM209468). In addition, the top two internodes of control and transgenic plants were used for total RNA extraction when control plants reached the E5 stage. qRT–PCR was used to validate the RNA sequencing results and for further analysis of differentially expressed genes among control plants and transgenic plants. The primers used for qRT–PCR are listed in Table S3.