Macrophage serum free media

Manufactured by Thermo Fisher Scientific

Sourced in United States

Macrophage serum-free media is a specialized cell culture media formulated to support the growth and maintenance of macrophages in the absence of serum supplements.

Automatically generated - may contain errors

Lab products found in correlation

Slide 8 well glass bottom, by Ibidi (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Ru486, by Merck Group (1 mentions) F4 80 pe cy7, by BioLegend (1 mentions) Spectral flow cytometer, by Cytek (1 mentions) Murine m csf, by Thermo Fisher Scientific (1 mentions) Cd11b apc, by BioLegend (1 mentions) Lightcycler 480 rna master hydrolysis probes kit, by Roche (1 mentions) Interleukin 4 (il 4), by R&D Systems (1 mentions) 6 well culture plate, by Corning (1 mentions) Imatinib mesylate, by Merck Group (1 mentions) Mifepristone, by Merck Group (1 mentions) Recombinant human m csf, by Miltenyi Biotec (1 mentions) Alexa fluor 594, by Thermo Fisher Scientific (1 mentions) Anti lamp1 clone d2d11, by Cell Signaling Technology (1 mentions) Recombinant human ifn γ, by BD (1 mentions) Lysosensor green dnd 189, by Thermo Fisher Scientific (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Bafilomycin a1, by Merck Group (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)

5 protocols using macrophage serum free media

Omentum Factors and Peritoneal Cell Activation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Omentum factors were generated by culturing the omentum from naïve mice in 1 ml of macrophage serum-free media (GIBCO) for 5 days as described^{5 (link)} after which medium was collected, centrifuged at 300 × g and the supernatant collected and diluted in 1:2 in media. Peritoneal cells were collected 11 days post low-dose zymosan were collected as described under sterile conditions and 5 × 10⁵ plated and incubated for 2 h at 37 °C in cell culture medium (RPMI, 10%FCS, 1% l-Glutamine and 1% penicillin/streptomycin supplemented with 20 ng/ml CSF1) after which medium was aspirated and cells were incubated in 250 μl cell culture medium with 250 μl Omentum factors or macrophage serum-free media with ATRA (Sigma, 1 μm) or without for 24 h. Then, medium was removed and plate was incubated with 5 mM EDTA in ice-cold PBS for 10 min on ice to collect cells. Wells were repeatedly washed with ice-cold 5 mM EDTA PBS and wells were inspected using a microscope to confirm negligible adherent cells remained. Cells were quantified and prepared for flow cytometry as described.

Louwe P.A., Badiola Gomez L., Webster H., Perona-Wright G., Bain C.C., Forbes S.J, & Jenkins S.J. (2021). Recruited macrophages that colonize the post-inflammatory peritoneal niche convert into functionally divergent resident cells. Nature Communications, 12, 1770.

+ Open protocol

+ Expand

Microglia Activation and Inflammatory Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following cell sorting, CD11b+ cells were suspended in Macrophage-Serum free Media (SFM Media, Gibco, Waltham, MA, USA) with 1% penicillin/streptomycin (Gibco, Waltham, MA, USA) at 6.10⁵ cells/mL concentration (0 days in vitro (DIV)). We used 12-well culture plates and µ-Slide 8 Well glass Bottom (Ibidi, Gräfelfing, Germany) containing 1 mL/well and 250 µL/well of cell suspension, respectively. The media were changed at 1 DIV. At 2 DIV, microglia cells were stimulated with RU-486 (Sigma-Aldrich, MI, USA) at 10⁻³ M concentration diluted in absolute ethanol. Group control was stimulated only by absolute ethanol at the same concentration. After 1 h of RU-486 incubation, IL-1β (50 ng/mL) and interferon (IFN)-γ (20 ng/mL) were added to the culture media (PBS for the control group). After 3 h of stimulation, the media were aspirated, and the 12-well plates were kept at −80 °C prior to mRNA extraction. The µ-slides were fixed at room temperature with 4% formaldehyde for 20 min.

Morin C., Guenoun D., Sautet I., Faivre V., Csaba Z., Schwendimann L., Young-Ten P., Van Steenwinckel J., Gressens P, & Bokobza C. (2022). The Impact of Mouse Preterm Birth Induction by RU-486 on Microglial Activation and Subsequent Hypomyelination. International Journal of Molecular Sciences, 23(9), 4867.

+ Open protocol

+ Expand

Isolation and Characterization of Bone Marrow-Derived Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Femurs and tibias from 8–10-week-old BL6 mice were flushed with RPMI medium (Gibco #72400-047, Billings, MT, USA) and the resulting single-cell suspension was filtered using a 70 µm cell strainer (Corning #431751, Corning, NY, USA) and centrifuged for 5 min at 420× g. Red blood cell lysis was performed by pouring 4 mL of sterile H₂O followed immediately by 46 mL of sterile PBS and centrifuged for 5 min at 420× g. BMDM were cultured in Macrophage Serum Free Media (Gibco #12065-074) supplemented with 100 ng/mL of murine M-CSF (Peprotech #315-02, Rocky Hill, NJ, USA) and pen–strep. After overnight incubation, floating cells were harvested and plated on two new cell culture plates and 30% of fresh medium was replaced every other day. BMDM were harvested on day 8. To confirm differentiation of bone marrow cells into BMDM, FACS staining was performed on day 8. Cells and controls were stained with CD11b-APC (BioLegend, San Diego, CA, USA, #101211) and F4/80-PE-Cy7 (BioLegend, #123113). For single-color controls, Anti-Rat Ig, κ/Negative Control Compensation Particles Set was used (BD Biosciences, 552844). Data were acquired using Aurora (Cytek, Fremont, CA, USA) Spectral Flow Cytometer. Macrophages were defined as CD11b⁺ F4/80⁺.

Żak M.M., Kaur K., Yoo J., Kurian A.A., Adjmi M., Mainkar G., Yoon S, & Zangi L. (2023). Modified mRNA Formulation and Stability for Cardiac and Skeletal Muscle Delivery. Pharmaceutics, 15(9), 2176.

+ Open protocol

+ Expand

Microglia Polarization and Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Microglia were plated at a density of 5 × 10⁵ cells/well in 6-well culture plates (Corning, Tewksbury, MA) and maintained in standard cell culture conditions for 24 hrs. Cells were switched to macrophage-serum free media (Life Technologies, Grand Island, NY) for 24 hrs, and ST-11 pre-treatment occurred for 1 hr before the end of the serum deprivation period. Cells were rinsed and returned to standard cell culture media and treated with IL-4 (10 ng/ml) (R&D Systems, Minneapolis, MN) or vehicle. Twenty-four hours later, cells were rinsed with PBS and frozen at -80°C until further use. RNA was isolated using a PerfectPure RNA Cultured Cell kit according to the manufacturer's instructions (5 PRIME, Gaithersburg, MD). Quantitative RT-PCR was performed with the LightCycler ® 480 RNA Master Hydrolysis Probes kit (Roche, Indianapolis, IN) using the following primers: FIZZ1 (probe 3) forward, tatgaacagatgggcctcct and reverse, aggcagttgcaagtatctcca; Ym1 (probe 88) forward, aagaacactgagctaaaaactctcct and reverse, gagaccatggcactgaacg; Ribosomal protein S5 (probe 71) forward, cactgcgtcgagtgaatcag and reverse, gctcatctgcaaggcactc; Eukaryotic translation initiation factor 4A2 (probe 53) forward, cgatctacctaccaatcgtgaa and reverse, acctttcctcccaaatcgac; Ubiquitin C (probe 11) forward, gaccagcagaggctgatctt and reverse, cctctgaggcgaaggactaa.

Fung S., Cherry A.E., Xu C, & Stella N. (2015). Alkylindole-sensitive receptors modulate microglial cell migration and proliferation. Glia, 63(10), 1797-1808.

+ Open protocol

+ Expand

Regulation of Macrophage Activation Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant human M-CSF was purchased from Miltenyi Biotec and recombinant human IFN-γ from Becton Dickinson. M-CSF was used at a concentration of 50 ng/ml and IFN-γ at a concentration of 10 ng/ml. Dexamethasone, hydrocortisone, imatinib mesylate, and mifepristone were from Sigma-Aldrich and used at the following concentrations: dexamethasone 10–1000 nM, hydrocortisone 300 nM, imatinib mesylate 5–10 µM, and mifepristone 1 µM. 25D3 and 1,25D3 were obtained from Biomol and used as indicated. Bafilomycin A1 was purchased from Sigma-Aldrich and Invivogen and used at 100 nM. The mAbs used were: anti–IL-15 PE (clone 34559) and IgG1 PE isotype control (clone 11711) from R&D Systems; anti-LAMP1 (clone D2D11) from Cell Signaling; anti-LAMP1 (clone eBioH4A3) from eBioscience; IgG1 pure isotype control (clone X40) and IgG2a isotype control (clone X39) from Becton Dickinson; anti-cathelicidin (clone OSX12) from Abcam or Novus Biologicals; and monoclonal anti-TCIRG1 from Abcam. Anti-mouse IgG1 PE (clone A85-1) and anti-mouse IgG2a FITC (clone R19-15) were obtained from Becton Dickinson. LysoSensor Green DND-189, DAPI, and secondary Abs labeled with Alexa Fluor 488 or Alexa Fluor 594 were purchased from Life Technologies. FCS and human AB serum were purchased from PAA Laboratories and PAN Biotech. RPMI 1640 and macrophage serum-free media (SFM) were obtained from Life Technologies.

Steiger J., Stephan A., Inkeles M.S., Realegeno S., Bruns H., Kröll P., de Castro Kroner J., Sommer A., Batinica M., Pitzler L., Kalscheuer R., Hartmann P., Plum G., Stenger S., Pellegrini M., Brachvogel B., Modlin R.L, & Fabri M. (2016). Imatinib Triggers Phagolysosome Acidification and Antimicrobial Activity against Mycobacterium bovis Bacille Calmette–Guérin in Glucocorticoid-Treated Human Macrophages. Journal of immunology (Baltimore, Md. : 1950), 197(1), 222-232.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!