Pcs 100 020
The PCS-100-020™ is a laboratory equipment product offered by American Type Culture Collection. It is designed for use in cell culture applications. The core function of the PCS-100-020™ is to provide a controlled environment for the growth and maintenance of cell cultures.
Lab products found in correlation
8 protocols using pcs 100 020
Primary Coronary Endothelial Cell Culture
Detecting Physiological Differences in Cell Cultures
Culturing Human Coronary Endothelial Cells
Modeling Cardiomyocyte Injury and Protection
Culturing Primary Human Coronary Endothelial Cells
Evaluating Endothelial Permeability with DOX and RXRA Agonists
For permeability assay, HCAECs were seeded at 1.5-fold of the confluent concentration on a ThinCert 0.4-μm translucent insert (Greiner) placed on a 24-well plate and grew for 48 hours. Cells were treated with DOX and RXRA agonists for another 24 hours. Medium in both the insert and outer wells were refreshed, and FITC (1 μg/μl) (4 kDa; Sigma-Aldrich) was added to the insert for 30-min incubation. Two hundred microliters of medium from the outer well was then used to quantify the FITC concentration using a microplate reader (Bio-Rad) at 490 nm.
Endothelial and Smooth Muscle Cells Oxidative Stress
The cells were seeded in a six-well plate for 24 h before transfection. When the cell confluence had reached about 50%, ECs, SMCs and HCAECs were transfected following the instructions of the lipofectamine 2000 reagents (Invitrogen Inc., Carlsbad, CA, USA). At 24 h after transfection, the cells were exposed to 50 μg/mL oxidized-low-density lipoprotein (ox-LDL) (Beijing Xiesheng Bio-Technology Limited, Beijing, China) for 24 h, or continued normal incubation [21] (link).
LncRNA HIF1A-AS2-specific small interfering RNA (siRNAs) including si-HIF1A-AS2-1 (sense AAGAGAUCUGUGGCUCAGUUCCUUU and antisense AAAGGAACUGAGCCACAGAUCUCUU) and si-HIF1A-AS2-2 (sense GAGUUGGAGGUGUUGAAGCAAAUAU and antisense AUAUUUGCUUCAACACCUCCAACUC), si-NC, overexpression plasmids including oe-USF1 (pcDNA3.1-USF1) and oe-ATF2 (pcDNA3.1-ATF2) as well as oe-NC (pcDNA3.1-NC) were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China).
Hypoxia-Reoxygenation Injury Model in HCAECs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!