Pancreatic islets from 16 weeks old db/+ and db/db mice were isolated as previously described [23] (link). Total RNA was isolated from tissues with Tri Reagent® (Sigma Aldrich) and reverse transcribed to cDNA with the use of random hexamers. Gene expression analysis was performed by Real-time PCR on a 7500 fast sequence detector (Applied Biosystems) using TaqMan gene expression assays (Applied Biosystems), including an 18S probe and primers for housekeeping measurements (Taqman references are included in Supplementary Fig. 3 ).
7500 fast sequence detector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 Fast Sequence Detector is a real-time PCR system designed for fast and accurate gene expression analysis. It features a 96-well block and supports a variety of fluorescent dye chemistries, enabling researchers to perform quantitative gene expression studies. The system provides rapid thermal cycling capabilities to generate results quickly.
Automatically generated - may contain errors
Lab products found in correlation
Tri reagent, by Merck Group (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions)
Abi 7900, by Thermo Fisher Scientific (1 mentions)
Sybr green chemistry, by Thermo Fisher Scientific (1 mentions)
Genejet rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Cfx384 thermal cycler, by Bio-Rad (1 mentions)
6 protocols using 7500 fast sequence detector
1
Pancreatic Islet Gene Expression Analysis
2
Quantifying Gene Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected, washed twice in PBS and RNA was isolated using GeneJet RNA extraction kit (Thermo-Scientific) qRT was performed using specific mRNA primers and SYBR green chemistry (Applied Biosystems). Reactions were carried out on a ABI 7900 or 7500 FAST sequence detector (Applied Biosystems). Relative mRNA values are calculated by the ∆∆Ct method. GAPDH was used as internal normalization controls where specified. The following qPCR primers were used SMAD7: 5′‐AAA CAG GGG GAA CGA ATT ATC‐3′, 5′‐ACC ACG CAC CAG TGT GAC‐3′; PAI-1; 5′-GTGTTTCAGCAGGTGGCGC-3′, 5′-CCGGAACAGCCTGAAGAAGTG-3′ ; CTGF: 5′-TAGGCTTGGAGATTTTGGGA-3′, 5′-GGTTACCAATGACAACGCCT-3′; GAPDH: 5′‐AAC AGC GAC ACC CAC TCC TC‐3′, 5′‐CAT ACC AGG AAA TGA GCT TGA C‐3′.
3
Quantitative Analysis of Muscle Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from skeletal muscle tissue with Tri Reagent (Sigma Aldrich) and reverse transcribed to cDNA with the use of random hexamers. Real-time PCR was performed on a 7500 fast sequence detector (Applied Biosystems). Each assay included a no-template control and a no-reverse transcriptase control. Oligos for PGC-1α (Mm01208835_m1), SIRT1 (Mm00490758_m1), mitochondrial transcription factor A (Tfam) (Mm00447485_m1), CD36 (Mm01135198_m1), CPT1b (Mm00487200m1), FABPpm (Mm02342495_m1), HSL (Mm00495359_m1), LPL (Mm00434770), nuclear respiratory factor 1 (Mm00447996_m1), FATP1 (Mm00449511_m1), ATGL1 (Pnpla2) (Mm00503040_m1), DGAT1 (Mm00515643_m1), and DGAT2 (Mm00499536_m1) were obtained from Applied Biosystems, TaqMan. Cyclophilin A (forward, aggatgagaacttcatcctgaagc; reverse, ttggcagtgcagataaaaaactg) was from Geneworks. The relative concentrations of measured mRNAs were determined by plotting the threshold cycle (Ct) versus the log of the serial dilution points, and the relative expression of the gene of interest was determined after normalization to 18S or cyclophilin A.
4
Quantitative RT-PCR Analysis of Adipogenic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocols for the DNA-free total RNA and cDNA preparation from cells and tissues have been described earlier [18 ]. Quantitative real-time PCR was performed in the ABI 7500 Fast Sequence detector using the TaqMan® Fast Universal PCR Master Mix and the following TaqMan® Gene Expression Assays (Applied Biosystems, Foster City, CA, USA): Adamts5 (Mm00478620_m1), peroxisome proliferator-activated receptor (Ppar)γ (Mm0044940_m1), preadipocyte factor 1 (Pref-1, Mm00494477_m1), and Ucp-1 (Mm01244861_m1). The expression of adipocyte protein 2 (Ap2; also known as fatty acid binding protein 4 or Fabp4) was determined with the primers and 6-carboxy-fluorescein (FAM) labelled probes reported elsewhere [19 ]. Fold differences in gene expression were calculated with the ΔΔCt method, using β-actin (Mm 01205647_g1) as a housekeeping gene.
5
RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed as previously described [16 (link)]. Briefly total RNA was isolated from tissues with Tri Reagent® (Sigma Aldrich) and reverse transcribed to cDNA with the use of random hexamers. Gene expression analysis was performed by Real-time PCR on a 7500 fast sequence detector (Applied Biosystems) using TaqMan gene expression assays (Applied Biosystems), including an 18S probe and primers for housekeeping measurements.
6
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated utilizing guanidine/phenolsolution (Qiazol-Qiagen USA). RNA quantity and quality were assessed by NanoDrop 2000 (Thermo scientific). One μg of total RNA was taken for the first-strand complementary DNA (cDNA) synthesis reaction (Hyper script RT PCR-GeneAll) according to the manufacturer's protocol. The real-time PCR was performed on a CFX 384 Bio-Rad thermal cycler (Bio-Rad). One microliter of cDNA of each sample was amplified using SensiMiX(Bioline) SYBR Green PCR Master Mix (2X) (Applied Biosystems-Amplicon, catalogue number 4309155) with 7500 Fast Sequence detector (Applied Biosystems, Foster City, CA, USA). The housekeeping gene GAPDH was measured in parallel as an internal control. The thermal profile used for the qRT‐PCR had three stages: 95 °C for 3 min (1 cycle); 95 °C, 57 °C, and 72 °C for 30 seconds each (40 cycles); 95 °C for 15 seconds and then 60 °C for 1 h (1 cycle). The fold change for each gene was determined after normalization to GAPDH using the 2−ΔΔCT method (Livak and Schmittgen, 2001[34 (link)]).
ΔCT= CTtarget -CtreferenceΔΔCt= ΔCTtest sample-ΔCTcontrol sampleRelative expression:2- ΔΔCtThe results are represented as the mean (± standard error of mean SEM) fold changes with respect to the sham control.
Primer sequences used are shown in Table 1(Tab. 1) .
ΔCT= CTtarget -CtreferenceΔΔCt= ΔCTtest sample-ΔCTcontrol sampleRelative expression:2- ΔΔCtThe results are represented as the mean (± standard error of mean SEM) fold changes with respect to the sham control.
Primer sequences used are shown in Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!