The largest database of trusted experimental protocols

Isolation trizol buffer

Manufactured by MultiSciences Biotech
Sourced in China

ISOLATION TRIzol buffer is a reagent used for the isolation and purification of RNA from various biological samples. It is a monophasic solution containing phenol and guanidine isothiocyanate, which facilitates the separation of RNA from DNA and proteins during the RNA extraction process.

Automatically generated - may contain errors

3 protocols using isolation trizol buffer

1

Quantification of miR-494-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cellular or exosomal total RNA was extracted utilizing ISOLATION TRIzol buffer® (Multi Sciences, Hangzhou), followed by cDNA synthesis from the reverse-transcribed RNA using the RT-PCR Kit (Yeasen, China) following the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed using the PerfectStart® Sybr qPCR Mix (Vazyme, Nanjing). Expression levels were determined using the 2−ΔΔCt method. The primers for miR-494-3p and U6 were as follows.
GeneForward seqReverse seq
U65′-AGGCTTGCTGCTCGGCAGTTGAT-3′5′-AAGCTAGCTGATCGATCGCTCT-3′
mi-494-3p5′-TGAAACATACACGGGAACCA-3′5′-ATGCTGCTAGCTGATCGCTAGCT-3′
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of ErbB4 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Following the supplier's protocol, total RNA was recovered from cells by using ISOLATION TRIzol buf-fer® (Multi Sciences, Hangzhou), and cDNA was obtained from reverse-transcribed RNA with the RT-PCR Kit (Yeasen, China). The qRT-PCR was used PerfectS-tart® Sybr qPCR Mix (Vazyme, Nanjing). The expression levels were calculated by 2 -ΔΔCt assay. Primers of ErbB4 and β-actin were stated below: β-actin (human): 5'-CCATCGCCAGTTGCCGATCC-3' (F) and 5'-GC-GAGAGGAGCACAGATACCACCAA-3' (R); ErbB4 (human): 5'-GTCCAGCCCAGCGATTCTC-3' (F) and 5'-AGAGCCACTAACACGTAGCCT-3' (R); ErbB4 (mouse): 5'-CCTTCCTGCGGTCTATCCGA-3' (F) and 5'-CCAAAGTTGCCATCTTTCCTGTA-3' (R); β-actin (mouse): 5'-GTGACGTTGACATCCGTAAAGA-3' (F) and 5'-GCCGGACTCATCGTACTCC-3' (R).
+ Open protocol
+ Expand
3

Quantifying Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Following the supplier's protocol, total RNA was recovered from cells using ISOLATION TRIzol buffer® (Multi Sciences), and cDNA was obtained from reverse‐transcribed RNA using an RT‐PCR kit (Yeasen). qPCR was performed using the PerfectStart® Sybr qPCR Mix (Vazyme). The expression levels of genes were calculated using the 2Ct method.26 The primer sequences for TNIP2 and‐actin were as follows: β‐actin:5′‐CCATCGCCAGTTGCCGATCC‐3′ (F) and 5′‐GCGAGAGGAGCACAGATACCACCAA‐3′ (R); TNIP2:5′‐AAGTCCTGACCAGTCGGAACA‐3′ (F) and 5′‐CCAGCAGGGACGAATACGTG‐3′ (R).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!