The largest database of trusted experimental protocols

Hiscript 2 reverse transcriptase reagent

Manufactured by Vazyme
Sourced in China

HiScript® II Reverse Transcriptase reagent is a high-performance reverse transcriptase enzyme used for the conversion of RNA to cDNA. It provides efficient and reliable RNA-to-cDNA conversion for downstream applications.

Automatically generated - may contain errors

2 protocols using hiscript 2 reverse transcriptase reagent

1

Circular RNA 0018168 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted via TRIzol reagent (Invitrogen) and then transcribed into cDNAs via the usage of HiScript® II Reverse Transcriptase reagent (Vazyme, Nanjing, China) or miRNA 1st Strand cDNA Synthesis reagent (Vazyme) and Random or Oligo (dT)18 primers. Thereafter, qRT-PCR was executed by using SYBR Premix DimerEraser (Takara, Dalian, China). The 2−ΔΔCt strategy was used to compute the relative expression. GAPDH and U6 were used as housekeeping genes. The primers were shown in Table 1. RNase R assay was performed on the RNA utilizing RNase R (Epicenter, Madison, WI, USA) to analyze the feature of circ_0018168.

Primers sequences used for qRT-PCR.

Table 1
NamePrimers (5′-3′)
hsa_circ_0018168ForwardGCGGAATTCCAAACCCTCAC
ReverseTGCTTCATTCGTATCCTCTCCTC
DKK1ForwardTGGAACTCCCCTGTGATTGC
ReverseAATAGGCAGTGCAGCACCTT
miR-330-3pForwardGTATGAGGCAAAGCACACGGC
ReverseCTCAACTGGTGTCGTGGAG
GAPDHForwardGACAGTCAGCCGCATCTTCT
ReverseGCGCCCAATACGACCAAATC
U6ForwardCTCGCTTCGGCAGCACA
ReverseAACGCTTCACGAATTTGCGT
18S rRNAForwardCAGCCACCCGAGATTGAGCA
ReverseTAGTAGCGACGGGCGGTGTG
+ Open protocol
+ Expand
2

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
One human immortalized epidermal cell line (HaCat) and three HNSC cell lines (M4E, CAL27 and TU686) were identified by STR. M4E, TU686 cells were cultured with RPMI1640 containing 10% fetal bovine serum (Gibco, Detroit, MI, USA) and penicillin (100 units/ml, Grand Island, NY, USA) and streptomycin (100 μg/ml, Grand Island, NY, USA). USA) and streptomycin (100 μg/ml, Grand Island, NY, USA) in RPMI1640 culture medium, HaCat, CAL27 cells were treated with 10% fetal bovine serum (Gibco, Detroit, MI, USA) and penicillin (100 units/ml, Grand Island, NY, USA) and streptomycin (100 μg/ml, Grand Island, NY, USA) in DMEM culture medium. Cells were incubated in a humidified environment in a constant temperature and humidity incubator at 37◦ C containing 5% CO2 and 95% air, and trypsin digested. Total RNA was extracted using FastPure Cell/Tissue Total RNA Extraction Kit (Vazyme, Nanjing, Jiangsu, China). Reverse transcription was performed according to the instructions of HiScript® II Reverse Transcriptase Reagent (Vazyme, Nanjing, Jiangsu, China). Quantitative polymerase chain reaction (Q-PCR) was performed with ChamQ Universal SYBR qPCR Master Mix reagent (Vazyme, Nanjing, Jiangsu, China) according to the instructions. GAPDH and U6 were used as internal reference genes. Relative expression was calculated using the ΔΔ-Ct method. The primer sequences are shown in Table S2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!