For IP assay, HEK293T cells that were transfected with FLAG-GFP or FLAG-NUP153 expression vector were lysed by sonication in IP lysis buffer (20 mM Tris–HCl, pH 7.9, 150 mM NaCl, 5 mM EDTA pH 8.0), 1% Nonident P-40, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM DTT, protease inhibitor cocktail (Sigma-Aldrich). After centrifugation, the supernatant was incubated with anti-FLAG M2 Affinity Gel beads (Sigma-Aldrich) at 4 °C for 2 h and the immune precipitates were subjected to western blotting. To prepare samples for the LC–MS/MS proteomics analysis, FLAG-NUP153 expression vector and mock transfected cells were lysed in elution buffer (10 mM PIPES, pH 6.8, 100 mM NaCl, 3 mM MgCl2, 0.3 M sucrose, 0.5% Triton X-100, 1 mM PMSF, 1 mM DTT, protease inhibitor cocktail (Sigma-Aldrich)) for 10 min on ice, the nuclear fraction containing pellet was collected by centrifugation 3 min, 500 × g, 4 °C and was subjected to IP assay as described above. The immune precipitates were eluted by incubation with FLAG peptide (F4799) (Sigma-Aldrich) at room temperature for 15 min and were subjected to silver staining by using SilverXpress (Invitrogen) or utilized for LC–MS/MS proteomics analysis.
Flag peptide f4799
Manufactured by Merck Group
Sourced in United States
The 3×Flag peptide (F4799) is a synthetic peptide that contains three copies of the FLAG epitope tag sequence. The FLAG tag is a widely used protein purification and detection tool that allows for the identification and isolation of recombinant proteins expressed in various systems. The 3×Flag peptide provides a high-affinity binding site for anti-FLAG antibodies, enabling efficient detection and purification of tagged proteins.
Automatically generated - may contain errors
Lab products found in correlation
Silverxpress, by Thermo Fisher Scientific (1 mentions)
Anti flag m2 affinity gel beads, by Merck Group (1 mentions)
Protease inhibitor cocktail, by Merck Group (1 mentions)
Anti gapdh sc 25778, by Santa Cruz Biotechnology (1 mentions)
Anti flag antibody f1804, by Merck Group (1 mentions)
Anti yy1 h 10 sc 7341, by Santa Cruz Biotechnology (1 mentions)
Anti gfp sc 9996, by Santa Cruz Biotechnology (1 mentions)
Anti influenza a virus np, by GenScript (1 mentions)
Anti phospho threonine, by Cell Signaling Technology (1 mentions)
Anti ha sc 805, by Santa Cruz Biotechnology (1 mentions)
Anti flag, by Merck Group (1 mentions)
Recombinant mouse gm csf 415 ml, by R&D Systems (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
Fitc conjugated goat anti rabbit immunoglobulin, by Merck Group (1 mentions)
5 protocols using flag peptide f4799
1
Isolation and Identification of NUP153 Interactors
2
Studying YY1, SET7/9, and LSD1 Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA specifically targeting YY1 (GACGACGACTACATTGAACAA), SET7/9 (TAGGGCCAGGGTATTATTATA) or LSD1/AOF2 (CTGGAAATGACTATGATTTAA) was purchased from Qiagen. Anti-YY1 K173me1 and anti-YY1 K411me1 antibodies were generated by GenScript, Inc. Antigen (peptide sequence) used for generating anti-YY1 K173me1 and anti-YY1 K411me1 was CSGGGRVK(me1)KGGGKKS and CKSHILTHAKAK(me1)NNQ, respectively; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate; anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory, Inc; anti-YY1(H-10) (SC-7341) and anti-GAPDH (SC-25778) was purchased from Santa Cruz Biotechnology. Flag peptide (F-4799) was purchased from Sigma; YY1K173me1 and YY1K411me1 peptides shared the same sequence as the ones used for antibody production.
3
Influenza Protein Interaction Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MG132 (133407-82-6) was purchased from APExBIO. anti-Flag M2 Affinity Gel (Flag beads, A2220), 3×Flag peptide (F4799), and chloroquine (CQ, C6628) were purchased from Sigma-Aldrich. Cycloheximide (CHX, HY-12320) was purchased from MedChemExpress (MCE). The following antibodies were used for co-Immunoprecipitation (co-IP) and western blotting: anti-Flag (F1804, Sigma), anti-α-Tubulin (PM054, MBL), anti-HA (sc-805, Santa Cruz), anti-GFP (sc-9996, Santa Cruz), anti-influenza A virus NP (A01506, GenScript), anti-phosphothreonine (9381, Cell Signaling Technology, CST). Mouse monoclonal anti-influenza A virus M1 antibody was kindly provided by Dr. Wenjun Liu (Institute of Microbiology, Chinese Academy of Sciences, Beijing, China).
4
Generation and Validation of Anti-mPINLYP Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TLR ligands ISD (tlrl-isdc), ISD control (tlrl-isdcc), poly (I:C) (tlrl-piclv), and poly(dA:dT) (tlrl-patc) were from InvivoGen. Recombinant mouse GM-CSF (415-ML) and mouse M-CSF (416-ML) were from R&D Systems. LPS (L4391), collagenase (C5138), and 3× Flag peptide (F4799) were from Sigma-Aldrich.
The polyclonal antibodies of mPINLYP were produced using two New Zealand White rabbits immunized with the purified mPINLYP protein by Applied Protein Technology (Shanghai). mPINLYP cDNA amplified from SL-1 cells (29 (link)) was cloned into pET21 vector with a His-tag, which was subsequently transformed into BL21 competent cells. After isopropyl-β-d -thiogalactopyranoside induction of mPINLYP expression and cell lysates were prepared, mPINLYP protein was purified using Ni-NTA agarose (Qiagen) according to the manufacturer’s instructions and used for immunization of White rabbits. Other antibodies are described in SI Appendix, Table S2 .
The polyclonal antibodies of mPINLYP were produced using two New Zealand White rabbits immunized with the purified mPINLYP protein by Applied Protein Technology (Shanghai). mPINLYP cDNA amplified from SL-1 cells (29 (link)) was cloned into pET21 vector with a His-tag, which was subsequently transformed into BL21 competent cells. After isopropyl-β-
5
Antibody Sources for Cell Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies were purchased from the following companies: two symplekin monoclonal antibodies (mAbs) were from Progen Biotechnik (cat #651100; Heidelberg, Germany) and BD Biosciences (cat #610644; Rockville, MD, USA); ZO-1 mAb (HPA001637), CSDA mAb (SAB1404593), GAPDH mAb (G8795), rabbit anti-FLAG (F7425) antibody, FITC-conjugated goat anti-rabbit Immunoglobulin G (IgG) antibody (F6005), anti-flag affinity gel (F2426), and 3 × FLAG Peptide (F4799) were from Sigma-Aldrich (St. Louis, MO, USA); ERK1/2 mAb (13–6200) and rabbit anti-β-catenin (AHO0462) antibody were from Invitrogen (Carlsbad, CA, USA); biotinylated rabbit anti-phosphoserine (ab9335) and rabbit anti-phosphothreonine (ab9340) antibodies were from Abcam (Cambridge, MA, USA); rabbit anti-E-cadherin (3195S) antibody was from Cell Signaling Technology (Beverly, MA, USA); tubulin-α mAb (66031) and LMNB1 mAb (66095) were from Proteintech (Wuhan, China); Cy3-conjugated goat anti-mouse IgG antibody (115-165-166) was from Jackson ImmunoResearch Laboratories (West Grove, PA, USA); peroxidase-conjugated goat anti-mouse IgG antibody (HD003-1) was from DingGuo (Beijing, China); and peroxidase-conjugated goat anti-rabbit IgG antibody (M21002) was from Abmart (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!