THP-1 cells were transfected with two short hairpin RNAs (shRNA) targeting RGC-32 using lentivirus vector GV248 (Genechem, Shanghai, China). The shRNA sequences were as follows: CACTCCTCAGAAAGCTAAA and ACAGACGATCCATGCTAAT. The RGC-32 over-expressing cell line were generated by lentivirus vector GV492 containing the full length sequence of RGC-32 (Genechem, Shanghai, China). The efficiency of RGC-32 knockdown and over-expression was validated by western blotting.
Gv248 lentivirus vector
Manufactured by Genechem
Sourced in China
The GV248 lentivirus vector is a laboratory tool used for gene delivery and expression. It serves as a vehicle to introduce genetic material into target cells. The vector's core function is to facilitate the incorporation of desired genes into the host cell's genome, enabling the expression of those genes.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Lentivirus vector gv492, by Genechem (1 mentions)
Lentivirus vector, by Genechem (1 mentions)
Rnase a, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Shanghai Zhong Qiao Xin Zhou Biotechnology (1 mentions)
Humidified incubator, by Thermo Fisher Scientific (1 mentions)
F12k medium, by Shanghai Zhong Qiao Xin Zhou Biotechnology (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Gv230 vector, by Genechem (1 mentions)
Gv358, by Genechem (1 mentions)
Polybrene and enhanced infection solution, by Genechem (1 mentions)
Pmd2 g, by Addgene (1 mentions)
7 protocols using gv248 lentivirus vector
1
RGC-32 Modulation in THP-1 Cells
2
Establishing SNHG3-overexpressing Cancer-associated Fibroblast Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain a cell line stably-expressing SNHG3, we entrusted the Genechem company to amplify the cDNA of SNHG3 and sub-clone it into the lentivirus vector (GV248, with a puromycin selection gene, Genechem, Shanghai, China). Meanwhile, the lentivirus vector overexpressing lncRNA SNHG3 and its corresponding control lentivirus vector (NC) were synthesized and assembled by Genechem. CAFs stably overexpressing SNHG3 were selected by adding puromycin (2 μg/mL). In general, the isolated CAFs were seeded into 6-well plates, at a density of 2 × 105 cells/well. Upon reaching 50%–60% confluence, lentivirus infection was carried out. Briefly, polybrene was diluted to a concentration of 50 μg/mL, and lentivirus was transfected with the multiplicity of infection of 50. Subsequently, the lentivirus was mixed with culture medium and polybrene diluent, and then added into the 6-well plates. After 72 h, CAFs were collected and EVs were isolated, and regarded as CAFs-EVs-NC and CAFs-EVs-SNHG3, respectively. In addition, CAFs were treated with RNase A alone (Sigma-Aldrich, 2 mg/mL) or RNase A combined with Triton-X-100 (0.1%) for 20 min to determine the presence of SNHG3 in CAFs-EVs.
3
Knockdown of AURKB using siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two segments of small interference RNAs (siRNAs) targeting AURKB were designed. The sequences were presented as follows: 5′-CCAAACTGCTCAGGCATAA-3′ (KD1, 58,972–1) and 5′-CCTTTGAGAGTGCATCACA-3′ (KD2, 58,974–1). A negative sequence (5′-TTCTCCGAACGTGTCACGT-3′) served as a control. The siRNAs were synthesized and inserted into GV248 lentivirus vector (Shanghai Genechem Co., Ltd, China), and then verified by DNA sequencing (Sanger). The siRNAs packaged with lentivirus vector were transfected into cells at a multiplicity of infection of 10 PFU per cell (MOI = 10). Two GC cell lines (AGS and MKN45) were divided into four groups, respectively: GC cells in the control group without any treatment (CON), GC cells in the negative control group (NC) transfected with the negative control segment, GC cells in KD1 group transfected with 58,972–1, and GC cells in KD2 group transfected with 58,974–1.
4
Knockdown of CPXM2 Using Lentiviral shRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four targeting shRNAs and a nontargeting scrambled RNA (scramble) were subcloned into the GV248 lentivirus vector by Shanghai GeneChem Co., Ltd., (Shanghai, China). The shCPXM2 target sequences were AGGTTCATCGTGGCATTAA (shCPXM2-1), ACGATGGAATTGACATCAA (shCPXM2-2), TCCCAATATCACCAGAATT (shCPXM2-3) and CTCAGTCCTGGTTTGATAA (shCPXM2-4). Lentiviral stocks were prepared and purified as previously described (20 (link)).
5
Lentiviral Knockdown of TAFA5 in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A gastric epithelial cell line (GES-1) and GC cell lines (AGS, HGC27, NCI-N87, MGC803 and SNU-1) were obtained from the Type Culture Collection of the Chinese Academy of Sciences. All of the cells were validated by short tandem repeat DNA profiling and were confirmed negative for Mycoplasma contamination. Cells were cultured in RPMI-1640 (BBI Life Sciences Corporation) or F12K medium (Zhong Qiao Xin Zhou Biotechnology Co., Ltd.) supplemented with 10% fetal bovine serum (cat. no. E600001; Sangon Biotech Co., Ltd.), 100 µg/ml penicillin, and 100 mg/ml streptomycin at 37°C with 5% CO2 in a humidified incubator (Thermo Fisher Scientific, Inc.).
Construction of TAFA5-targeting short hairpin (sh)-RNAs and packaging of lentiviruses. Two targeting shRNAs (shTAFA5-1 and shTAFA5-2) and a nontargeting scrambled RNA (scramble) were subcloned into the GV248 lentivirus vector by Shanghai GeneChem Co., Ltd. The shTAFA5-1 target sequence was 5′-CGCAAGAATCATCAAGACCAA-3′, and the shTAFA5-2 target sequence was 5′-CACCTGTGAGATTGTGACCTT-3′. Lentiviral stocks were prepared, as previously described (15 (link)).
Construction of TAFA5-targeting short hairpin (sh)-RNAs and packaging of lentiviruses. Two targeting shRNAs (shTAFA5-1 and shTAFA5-2) and a nontargeting scrambled RNA (scramble) were subcloned into the GV248 lentivirus vector by Shanghai GeneChem Co., Ltd. The shTAFA5-1 target sequence was 5′-CGCAAGAATCATCAAGACCAA-3′, and the shTAFA5-2 target sequence was 5′-CACCTGTGAGATTGTGACCTT-3′. Lentiviral stocks were prepared, as previously described (15 (link)).
6
Modulating ETV6 Expression in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the stable overexpression and knockdown of ETV6 in colorectal cancer cells, one ETV6 cDNA and three independent shRNAs were designed and cloned into the GV358 and GV248 lentivirus vector (GeneChem), respectively. The plasmid sequences were confirmed by DNA sequence analysis. The sequences of three shRNAs are shown in Supplementary Table 10 . The vectors were transfected using the Polybrene and Enhanced Infection Solution according to the manufacturer's protocol (GeneChem). The cells were infected with lentivirus at a multiplicity of infection of 10. The transfected cells were further selected with 2 μg ml−1 puromycin for 2 weeks. The stable effect of ETV6 overexpression and knockdown was determined by quantitative RT–PCR and western blot (Supplementary Fig. 19 ).
For the transiently transfected SW480 cells, the ETV6 overexpression vector was constructed and cloned into the GV230 vector (GeneChem). The plasmid sequences were confirmed by sequencing. For transient transfection, Lipofectamine 2000 transfection reagent (Invitrogen) was used according to the manufacturer's protocol.
For the transiently transfected SW480 cells, the ETV6 overexpression vector was constructed and cloned into the GV230 vector (GeneChem). The plasmid sequences were confirmed by sequencing. For transient transfection, Lipofectamine 2000 transfection reagent (Invitrogen) was used according to the manufacturer's protocol.
7
Overexpression and Knockdown of LSD1 and OVOL2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LSD1 coding sequence was amplified from the cDNA of HEK 293 T cells and subcloned into the lentiviral vector pCDH (Addgene #72265) for overexpressing LSD1. The primers used for molecular cloning are provided in Supplementary Table S2 . GV248 lentivirus vector (GeneChem Co., Ltd., Shanghai, China) was used to stably knock down OVOL2 gene expression. The targeting shRNA sequences are: shOVOL2: CAGGCATTCGTCCCTACAAAT; negative control (GV-NC): TTCTCCGAACGTGTCACGT. HEK 293 T cells were transfected with pCDH-LSD1/GV248 and packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) using Lipofectamine3000 (Thermo Fisher, L3000015) according to the manufacturer's instructions. The supernatant containing viruses was collected, filtered, and used for infection after 24 h and 52 h of transfection. NCM 460 cells or LSD1 KO HCT116 cells were infected with supernatant containing lentivirus mixed with complete culture medium at a ratio of 1:1 for 24 h, and then subjected to 1 μg/ml puromycin treatment for 3 days. Immunoblotting or qPCR was subsequently performed to examine the overexpression or knockdown efficiency.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!