The largest database of trusted experimental protocols

Nanometer photometer

Manufactured by Implen
Sourced in Japan, Germany, United States

The Nanometer Photometer is a highly precise instrument designed for the measurement of absorbance and concentration of samples in the nanometer range. It offers accurate and reliable results for a variety of applications, including nucleic acid and protein quantification.

Automatically generated - may contain errors

3 protocols using nanometer photometer

1

Quantitative Analysis of Aortic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Aortic specimens were ground in liquid nitrogen, and RNAiso Plus reagent (Takara 9109, Shiga, Japan) was used to extract total RNAs, and the concentration and purity of total RNA were detected by a nanometer photometer (IMPLEN). After that, reverse transcription was performed using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa RR047A, Shiga, Japan). Real-time quantitative polymerase chain reaction (RT-qPCR) was conducted using TB Green® Premix Ex Taq (TaKaRa RR420A, Shiga, Japan) on an ABI Q3 7500 Real-Time PCR System (ABI). ACTB was used as internal controls, and the relative expression level of the target gene was calculated as 2−ΔCt, where −ΔCt = (Ct, target gene − Ct, ACTB). Statistical analysis was conducted with GraphPad Primer 8.0 (GraphPad Software Inc., GraphPad Prism 8.0.1.2). Primer sequences used in the study were listed in Supplementary Table 3.
IL-1β and CLEC4E concentrations in the serum were measured using a commercial ELISA kit according to the manufacturer’s instructions (#KET6013, EliKine Human IL-1β ELISA Kit; Abbkine Scientific Co., Ltd., Wuhan, China; # EK3805, Human C-type lectin domain family 4 member E ELISA Kit; Sabbiotech, College Park, MD, United States).
+ Open protocol
+ Expand
2

Transcriptional Profile of Germ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the manufacturer’s instructions, total RNA was extracted from OGSCs by the Trizol method(Invitrogen,Germany), and the concentration and purity of total RNA were detected by a nanometer photometer(IMPLEN, Germany). The measured optical density was 1.8 < A260/A280 < 2.2.RNA expression was detected by 2% agarose gel electrophoresis(Bio-Rad, USA). Table 1 contains the list of primers used in this study.

Sequences used for Reverse Transcription- PCR

GeneForward primer (5′-3′)Reverse primer (5′-3′)
GAPDHAACGGATTTGGCCGTATTGGCATTCTCGGCCTTGACTGTG
MVHGTGTATTATTGTAGCACCAACTCGCACCCTTGTACTATCTGTCGAACT
FragilisCTGGTCCCTGTTCAATACACTCTTCAGTCACATCACCCACCATCTT
OCT-4AGCTGCTGAAGCAGAAGAGGGGTTCTCATTGTTGTCGGCT
StellaCAGTCTACGGAACCGCATTGCTTGGGAAAGGCGCTTTGAA
DazlGCCCTGCAATCAGGAAACAAGGTTGGAGGCTGCATGTAAG
c-KitAACAGGACCTCGGCTAACAAACTGGCATCAGAGTTGGACA
ZP3CTCTCCAGTTCACGGTGGATCGACTTTGAGATGGCAGGTG
Scp3GCCGCTGAGCAAACATCTAAGGCTTCCCAGATTTCCCAGA
FiglaAGCAGGAAGCCCAGTAAAGTGCTCCTCAGGGCTTTGTTTC
+ Open protocol
+ Expand
3

Characterization of Garlic Transcriptome

Check if the same lab product or an alternative is used in the 5 most similar protocols
Garlic samples were collected form Pizhou, China (abbreviation: PW), and cultivated in the test farm (Xuzhou city, Jiangsu province) in an area of more than 100m 2 . Vernier calipers were used to measure garlic leaf length, width and thickness at maturity in plants with a similar phenotype. Samples were obtained at 0, 3, 6 and 12h after wounding. Garlic root, clove, inner bud and sprout samples were also collected (Fig. 1a) then immediately frozen in liquid nitrogen and stored at 80 ℃ until use. Total RNA was extracted using a Plant Total RNA Isolation Kit(Vazyme, China) according to the manufacturer. DNase I (Vazyme, China) was added to the mixture to prevent DNA contamination. Puri ed RNA was analysed by 1% agarose gel electrophoresis and the quality of total RNAs was con rmed using an RNA 6000 Nano LabChip kit (Agilent, Santa Clara, CA, USA) with an RNA integrity number > 7.0.quantitatively detected by using an Implen nanometer photometer using with Nanodrop with and an RNA integrity number > 7.0.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!