Supercoiled plasmids were extracted from E. coli XL1-Blue using NucleoSpin Plasmid (Macherey-Nagel) or NucleoBond Xtra Midi (Macherey-Nagel) accordingly to the manufacturer instructions. Relaxed pCB568 and pCB598 were obtained by Nt.BspQI digestion (NEB) followed by a column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). ScaI and PvuII pCB568 fragments were obtained by ScaI and PvuII digestion (FastDigest, ThermoFisher) followed by a gel purification of the desired fragment (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). Linear pCB598 was obtained by ScaI digestion (FastDigest, ThermoFisher) followed by a gel purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). A 2,106-bp fragment of pCB568 was amplified by Phusion Polymerase (ThermoFisher) with the primers pUC1481-1503 and P30-REV followed by column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). The various fragments of 800 bp were amplified from the appropriate plasmid by Phusion Polymerase (ThermoFisher) with the primers pUC195-217 and pZE21_rev followed by column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel).
Phusion polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Finland, France, Canada
Phusion polymerase is a high-fidelity DNA polymerase enzyme used for polymerase chain reaction (PCR) amplification. It possesses 3'→5' exonuclease activity, providing proofreading capability to enhance the accuracy of DNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (24 mentions)
T4 ligase, by Thermo Fisher Scientific (10 mentions)
Restriction enzyme, by Thermo Fisher Scientific (8 mentions)
Dntps, by Thermo Fisher Scientific (8 mentions)
T4 dna ligase, by New England Biolabs (8 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (8 mentions)
Superscript 3, by Thermo Fisher Scientific (7 mentions)
Restriction enzyme, by New England Biolabs (7 mentions)
Qiaquick pcr purification kit, by Qiagen (7 mentions)
Qiaquick gel extraction kit, by Qiagen (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Dpni, by Thermo Fisher Scientific (6 mentions)
Turbofect, by Thermo Fisher Scientific (6 mentions)
Dnase 1, by Thermo Fisher Scientific (6 mentions)
Nucleospin gel and pcr clean up kit, by Macherey-Nagel (5 mentions)
Dpni, by New England Biolabs (5 mentions)
Bp clonase 2, by Thermo Fisher Scientific (5 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (5 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
In fusion hd enzyme, by Takara Bio (4 mentions)
407 protocols using phusion polymerase
1
Plasmid Extraction and Fragment Preparation
2
Cloning and Mutagenesis of HNF1A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCDH plasmid (System Biosciences) containing the CMV promoter, N-terminal FLAG tag coding sequence and ampicillin resistance gene was used as the expression vector for HNF1A. HNF1A coding sequence was cloned from pLENTI-HNF1A (Origene). PCR products were inserted into the pCDH vector using the Quick Ligation Kit (NEB). The ligated plasmid was used to transform STBL3 competent cells (Thermo Fisher Scientific). Inserted sequences were verified by DNA sequencing. For site-directed mutagenesis, the p.H126D c.376 C > G mutation was generated using the following primers to replace a cytosine base to guanine base in the HNF1A coding sequence through a PCR using the Phusion polymerase (Thermo Scientific): Forward primer 5′ TACCTGCAGCAGGACAACATC 3′; Reverse primer: 5′ GATGTTGTCCTGCTGCAGGTA 3′, while the P291fsinsC mutation was generated using the following primers to introduce an additional cytosine base in the HNF1A coding sequence through a PCR using the Phusion polymerase (Thermo Scientific): Forward primer 5′ GGCCCCCCCCCAGGG 3′; Reverse primer: 5′ CCCTGGGGGGGGGCC 3′. The parental strand was digested following incubation with Dpn1 (NEB). Introduced mutations were verified by DNA sequencing.
3
CiaR Binding Site Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Putative promoter fragments (∼125 bp) encompassing the determined CiaR binding motif (see above) and the coding sequence of Spy_sRNA195261 (negative control) were amplified from S. pyogenes SF370 chromosomal DNA by PCR using primers listed in Table S3. Phusion polymerase (Finnzymes) was used and the amplified fragments were purified using a PCR purification kit (Qiagen). 40 ng (0.5 pmol) of DNA fragments were incubated in 15 μl reactions in band shift buffer (20 mM HEPES, 10 mM (NH4)2SO4, 1 mM DTT, 30 mM KCl, 10 mM MgCl2, pH 7.9) as previously described31 (link) with varying amounts of purified His-tagged CiaR. Reactions were incubated at room temperature for 30 min and loaded on native 8% polyacrylamide gel in 1× TGE (50 mM Tris, 400 mM glycine, 1.73 mM EDTA). Bands were visualized with a 3 min EtBr staining. PCR fragment without the CiaR binding motif served as a DNA negative control.
4
Engineered IL-2 Fusion Proteins with NARA1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 14
DNA sequences coding for human IL-2 (pORF-hIL-2 plasmid, Invivogen, porf-hIL-2) and the light chain of NARA1 were subcloned by cut and paste and ligated using standard cloning techniques (PCR amplification/assembly using phusion polymerase, Finnzymes, F-530S) adding within the primers the linkers aimed for (e.g 15, 20 or 25 amino acid linkers as shown in tables Table 35, Table 36, and Table 37). The resulting PCR products were inserted by cut and paste into expression vectors suitable for secretion in mammalian cells. The heavy chain of NARA1 and light chain of NARA1 fused to hIL-2 were cloned into individual expression vectors to allow co-transfection. Elements of the expression vector include a promoter (Cytomegalovirus (CMV) enhancer-promoter), a signal sequence to facilitate secretion, a polyadenylation signal and transcription terminator (Bovine Growth Hormone (BGH) gene), an element allowing episomal replication and replication in prokaryotes (e.g. SV40 origin and ColE1 or others known in the art) and elements to allow selection (ampicillin resistance gene and zeocin marker).
5
Fib2-roGFP Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For construction of the Fib2-roGFP plasmid, the GAR domain (amino acids 1–73) of the Arabidopsis Fibrillarin 2 (Fib2) gene was PCR amplified with Phusion polymerase (Finnzymes) using the primers Fib2_KpnI and Fib2_BamH1 to add KpnI and BamHI restriction sites (Supplementary Table S1 ). The PCR product was cloned blunt-end into the vector pGEM-T (Promega). The GAR domain was then subcloned into the expression vector pBinAR-GRX1-roGFP2 (Marty et al., 2009 ) with KpnI and BamHI. The construct was transformed into Agrobacterium strain C58C1 and used for Arabidopsis transformation.
6
Generating C. elegans Transgenic Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten HOT core sites were PCR amplified from N2 genomic DNA using Phusion polymerase (Finnzymes) and Gateway cloned (Invitrogen) into pDONR221 (regions given in Supplemental Table S1). To create transgenes to test whether HOT regions could function as promoters, MultiSite Gateway cloning (Invitrogen) was used to recombine the HOT regions upstream of his-58 (pJA272) and gfp∷tbb-2 3′UTR (pJA256) sequences on the MosSCI compatible vector pCFJ150, which targets Mos site Mos1(ttTi5605) chrII (Zeiser et al. 2011 (link)). C. elegans MosSCI lines were generated as described (Frøkjær-Jensen et al. 2008 (link)), injecting strain EG6699 with injection mixes that contained pCFJ103(40 ng/µL), pCFJ90(5 ng/µL), pCFJ104(2.5 ng/µL), and expression clones at 40 ng/µL. Supplemental Table S2 lists all strains generated in this study. All strains were used and cultured using standard methods (Brenner 1974 (link)). Transgenic strains were grown at 25°C prior to microscopic examinations. Young adult or L4 stage worms were sedated in 5 mM Tetramisole, aligned, and scanned in groups at controlled laser and scanning settings. A full list of primers used for generation of pDONR221 promoter constructs can be found in Supplemental Table S3.
7
Gateway Cloning and Site-Directed Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the oligonucleotides used in this study, see Table S2 in the supplemental material.
DNA constructions were performed with the Gateway recombinational cloning system as recommended by the manufacturer (Invitrogen) or by restriction-ligation molecular cloning. Plasmid DNA from E. coli was prepared by Plasmid Midi and Mini kits (Qiagen). PCR amplifications were carried out with Phusion polymerase as recommended by the manufacturer (Finnzymes). Site-directed mutagenesis experiments were performed with the QuikChange II site-directed mutagenesis kit (Stratagene). To obtain the kinase-dead mutant protein LegK2K112M defective in phosphate donor ATP binding and the kinase-dead mutant protein LegK2K112M/D209N defective in both phosphate donor ATP binding and phosphate transfer, nucleotide substitutions in the legK2 gene were performed with primer pairs 1/2 and 3/4 (seeTable S2 ).
DNA constructions were performed with the Gateway recombinational cloning system as recommended by the manufacturer (Invitrogen) or by restriction-ligation molecular cloning. Plasmid DNA from E. coli was prepared by Plasmid Midi and Mini kits (Qiagen). PCR amplifications were carried out with Phusion polymerase as recommended by the manufacturer (Finnzymes). Site-directed mutagenesis experiments were performed with the QuikChange II site-directed mutagenesis kit (Stratagene). To obtain the kinase-dead mutant protein LegK2K112M defective in phosphate donor ATP binding and the kinase-dead mutant protein LegK2K112M/D209N defective in both phosphate donor ATP binding and phosphate transfer, nucleotide substitutions in the legK2 gene were performed with primer pairs 1/2 and 3/4 (see
8
Generating Yersinia enterocolitica Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains and constructs used in the experiments are listed in S2 Table . E. coli Top10 and BW19610 were used for cloning and E. coli SM10 λ pir+ for conjugation. E. coli strains were grown routinely on Luria–Bertani (LB) agar plates or in liquid LB medium at 37°C. Ampicillin and streptomycin were used at concentrations of 200 µg/ml and 100 µg/ml to select for expression vectors and suicide vectors. All Y. enterocolitica strains were based on strain IML421asd [41 (link)], which lacks the effectors YopH, YopO, YopP, YopE, YopM, and YopT and is auxotrophic for diaminopimelic acid due to an additional mutation in the aspartate-β-semialdehyde (asd) gene. Y. enterocolitica were routinely grown at 25°C in brain heart infusion (BHI) broth containing nalidixic acid (35 µg/ml) and diaminopimelic acid (80 µg/ml). Plasmids were generated using Phusion polymerase (Finnzymes). Mutators for modification or deletion of genes in the pYV plasmids were constructed as described earlier [49 (link)]. All constructs were confirmed by sequencing (Source BioScience).
Y. enterocolitica mutants were generated by allelic exchange, replacing the WT gene on the virulence plasmid by the mutated version. Completion of the allelic exchange was tested for by plating diploid bacteria on plates containing 5% sucrose [82 (link)].
Y. enterocolitica mutants were generated by allelic exchange, replacing the WT gene on the virulence plasmid by the mutated version. Completion of the allelic exchange was tested for by plating diploid bacteria on plates containing 5% sucrose [82 (link)].
9
Binary vector pBI-121 construction for plant transformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The binary vector pBI-121 [54] was used in this study. The isolated promoters were inserted into this binary vector and replacing the CaMV 35S promoter. Diagrammatical construct can be seen in Figure 1 . The construction of plant transformation vector was generated by using Overlap extension PCR cloning (OEPC) method [55] (link). In present study we used Phusion Polymerase (Finnzymes). Specific OEPC primer for constructing the vectors can be seen in Table 1 . In order to verify the correct integration, the plasmids were sequenced using each specific promoter forward primer and gus-Seq R primer (Table 1 ).
10
Ectopic Expression of Flag-tagged BRM and BRG1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNAs encoding the N-terminal flag-tagged human BRM and N-terminal flag-tagged BRG1 proteins were a gift from B. Emerson. These cDNAs were subcloned into the SmaI–SalI (New England Biolabs) sites of the pAD5-CMV-Wpre-PGK-Puro expression vector (a kind gift from S. Philipsen). The mutation K755A (19 (link)) was introduced using a two-step mutagenic PCR procedure using Phusion polymerase (Finnzymes). The interfering shRNA oligonucleotides targeting human SMARCA2 and SMARCA4 transcripts were designed using the SiDesign Center (Dharmacon). The shRNA primers were cloned into pSUPuro vector. pSUPuro, and the pSUPuro ß2 T-Cell Receptor Beta used as an unrelated control shRNA were gifts from M.D. Ruepp. BARD1 and BRCA1 constructs were a gift of N. Chiba. The cDNA encoding CstF50 was subcloned from pcDNA3 HA-CstF50 (a gift from M.D. Ruepp) into a p3XFLAG-myc-CMV26 removing the myc tag. The histidine-tagged Ubiquitin was a gift of M.L. Guerrini. All constructs were verified by sequencing (BMR Genomics). All oligonucleotide sequences are listed in Supplementary Table S2. The commercial antibodies used are listed in the Supplementary Table S1. Non-immune rabbit IgGs (Millipore) were used as a control in the immunoprecipitation assays.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!