Sybr exscript rt pcr kit

After reperfusion, total RNA was isolated from hearts with TRIzol reagent (Invitrogen, U.S.A.) according to the manufacturer’s manual. Complementary DNA (cDNA) was synthesized using the TaqMan microRNA reverse Transcription Kit (Applied Biosystems, U.S.A.) with U6 and miRNA specific stem-loop primers. Taqman MicroRNA assays and Taqman Universal PCR Master Mix detected miR-7-5p. For MEG3, quantitative real-time PCR (qRT-PCR) analysis was performed with a SYBR ExScript RT-PCR kit (Takara, China). The primers used to target sequences of miR-7-5p, U6, MEG3, and β-actin were as following (5′–3′): miR-7-5p: forward, ACACTCCAGCTGGGTGGAAGACTAGTGATTTT; reverse, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACAAA; U6: forward, CTCGCTTCGGCAGCACA; reverse, AACGCTTCACGAATTTGCGT; MEG3 (rat): forward, GGGTAGTGGGGACATTAGG; reverse, GAAGGAAAGCAGCGAGTG; MEG3 (human), forward: CTGACTCGCTCTACTCCGTG; reverse, AGGGGATGCTAAGAACGAGA; β-actin (rat): forward, GGAGATTACTGCCCTGGCTCCTA; reverse, GACTCATCGTACTCCTGCTTGCTG; β-actin (human): forward, ATCGTGCGTGACATTAAGGAGAAG; reverse, AGGAAGGAAGGCTGGAAG AGTG. Relative expression level of miR-7-5p was normalized to U6, and that of MEG3 was normalized to β-actin.

Total RNA was extracted using a mirVana miRNA isolation kit (Thermo Fisher Scientific). A High Capacity RNA-to-cDNA Master Mix (Life Technologies) was used to synthesize cDNA. Real-time quantitative PCR was performed using the SYBR ExScript RT-PCR kit (TaKaRa, Dalian, China) on an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) according to manufacturer’s instructions. The thermocycling profiles were as follow: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The sequences of the primers are shown in Table 3.

Real-time RT–PCR was used to determine the mRNA level of specific genes in the cells grown with tryptanthrin, when compared to their expression in the cells grown without tryptanthrin. One biofilm formation–related gene, six genes involved in the flagellar biosynthesis, and three hemolysins and luxO genes were chosen. To collect samples for quantitative real-time RT–PCR, overnight culture of V. splendidus AJ01 was inoculated into media with or without 2.5 μg/mL tryptanthrin, respectively. The cultures were grown to OD₆₀₀ value of approximately 0.4; then, the cultures were centrifuged to collect the cell pellet. TRIzol was used to extract RNA, and ABclonal reverse transcription kit (ABclonal Technology Co., Wuhan, China) was used to synthesize cDNA. The primers in the real-time RT–PCR for each gene are listed in Table 1. Real-time RT–PCR experiment was performed in the ABI 7500 real-time system (Applied Biosystems, the USA) based on the SYBR ExScript RT–PCR kit (Takara, China). The experiment was carried out in triplicate using 16S rRNA as a control gene. Dissociation analysis of the PCR products was carried out at the end of each PCR, which was used to verification that only one DNA product was successfully amplified. The comparative 2^–△△CT method was occupied to compare the mRNA levels between different samples.

Frozen ovaries were pooled and homogenized, and RNA was extracted. qRT-PCR was performed with 300 ng of target RNA and Alu-specific primers^{47 (link)} (Applied Biosystems) using a SYBR ExScript RT-PCR Kit (TaKaRa) and cycling conditions of 2 min at 95 °C, followed by 40 cycles of 5 s at 95 °C and 30 s at 56 °C. The primer sequences for the human Alu-sequence primers and β-actin were 5′-CTGGGCGACAGAACGAGATTCTAT-3′ (forward) and 5′-CTCACTACTTGGTGACAGGTTCA-3′ (reverse) for the Alu sequence and 5′- TCC TTC TGC ATC CTG TCA GCA-3′ (forward) and 5′- CAG GAG ATG GCC ACT GCC GCA-3′ (reverse) for β-actin. The values were normalized to rat β-actin gene (in triplicate). The oogenesis-related proteins Nanos3, Nobox and Lhx8, their mRNA levels were determined with cycling conditions of 10 min at 95 °C, and 40 cycles of 10 s at 95 °C and 30 s at 59 °C (in duplicate). The values were normalized to rat GAPDH gene (Table 1).

Specific primer pairs were designed using Primer 5.0 software. Primers that had high specificity and efficiency on the basis of melting curve analysis were used to conduct quantification analysis (Supplementary Table S1). Moreover, PCR products were sequenced to confirm the specificity of primer pairs. Amplification efficiencies of primer pairs ranged from 0.9 to 1.1. The levels of MaSS and SISSIII-1 expression were quantified by qRT-PCR using an iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) with the SYBR ExScript RT-PCR Kit (TaKaRa, Dalian, China). ACTIN or GAPDH that were verified to be constitutive in expression and hence suitable to be used as internal controls were used as reference genes to normalize transcriptional levels of each MaSS gene and SISSIII-1 (Supplementary Table S1). Relative expression levels of four MaSS genes were analyzed in three technical replicates and calculated using the 2^-ΔΔCT method (Livak and Schmittgen, 2001 (link)). Each sample contains three biological replicates.

Total RNA was extracted from various tissues of G. biloba using a plant RNA isolation kit (BioTeke, Beijing, China) following the manufacturer’s instructions. All RNA samples were digested with DNase I (RNase-free) prior to use. Aliquots of 1 μg of total RNA were employed in the reverse transcriptase reaction using random hexamer primers for the synthesis of first-strand cDNA. The amplification reactions of RT-Q-PCR were performed on a LightCycler^® 96 Real-Time PCR System (Roche) with gene-specific primers, and the SYBR ExScript RT-PCR kit (Takara, Shiga, Japan) was used to confirm changes in gene expression. The thermal cycle conditions used were 5 min at 95°C followed by 40 cycles of amplification (15 s at 95°C, 15 s at 60°C and 30 s at 72°C). A melt curve analysis following each RT-Q-PCR was performed to assess product specificity. Expression patterns of ginkgolide biosynthesis key genes were analyzed in three biological replicates. Quantification of the target gene expression was carried out with comparative CT method (Livak and Schmittgen, 2001 (link)). The primers used in RT-Q-PCR are listed in Supplementary Table S3.

The expression levels of AaAOC and key genes of artemisinin biosynthetic pathway in AaAOC-overexpression A. annua were analysed by RT-Q-PCR method. All RNA samples were digested with DNaseI prior to use. Aliquots of 0.4 µg total RNA were employed in the reverse transcriptase reaction using random hexamer primers for the synthesis of first strand cDNA. The amplification reactions of RT-Q-PCR were performed on an iCycler iQTM Real-Time PCR Machines (Bio-Rad, Watford, UK), and the SYBR ExScript RT-PCR kit (Takara, Shiga, Japan) protocol to confirm changes of gene expression. Procedures of RT-Q-PCR were performed as previously described [26] (link). The actin gene was used as the constitutive control gene. All the primers used in RT-Q-PCR were listed in Table S1 in File S1.