Samples and pre-stained standard separated on a 4–12% NuPAGE™ (Invitrogen) were transferred onto a piece of Immobilon™ membrane (Millipore, Bedford, MA). The membranes were rinsed with TBS-T (TBS containing 0.05% Tween 20), blocked with 5% nonfat dry milk at room temperature for 1 h, and incubated with appropriately diluted (1:500 ~ 2000) 1st antibodies overnight at 4 °C. The first antibodies were rabbit IgG purchased from Cell Signaling (Beverly, MA), including anti-I-κBα (#9242), anti-GAPDH (#2118), anti-phospho-p44/42 (#9101, Thr202/Tyr204), anti-p44/42 (#9102), anti-phosphorylated p38 (#9211, Thr180/Tyr182), anti-p38 (#9212), anti-phosphorylated JNK (#9251, Thr183/Tyr185), anti-JNK (#9252), anti-phosphorylated p53 (#9284, Ser15), anti-Cdc2 (#77,055), and anti-cyclin B1 (#4138). After washing three times with TBS-T, the membranes were reacted with 1:2000 diluted HRP-conjugated goat anti-rabbit IgG (Cell Signaling, #70,741) for 1 h at room temperature, washed, and developed in SuperSignal® West Dura Extended Duration Substrate (Thermo Fisher Scientific Inc., Hanover Park, IL). The images were collected using the G BOX Chemi systems (Syngene, Frederick, MD).
Immobilon membrane
Manufactured by Merck Group
Sourced in United States, Germany, United Kingdom, Japan
Immobilon membrane is a microporous membrane made of PVDF (polyvinylidene fluoride) material. It is designed for use in various laboratory applications, including Western blotting, dot blotting, and other immunodetection techniques. The membrane provides a stable and efficient platform for the immobilization of proteins, nucleic acids, and other biomolecules.
Automatically generated - may contain errors
Lab products found in correlation
Polyacrylamide gel, by Thermo Fisher Scientific (16 mentions)
Image studio, by LI COR (13 mentions)
Vertical 1.5 agarose gel, by Bio-Rad (6 mentions)
T per, by Thermo Fisher Scientific (6 mentions)
Chemidoc mp imaging system, by Bio-Rad (6 mentions)
Bullet blender, by Next Advance (5 mentions)
Enhanced chemi luminescence (ecl), by Cytiva (5 mentions)
Gapdh, by Cell Signaling Technology (5 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (5 mentions)
Anti calnexin, by Enzo Life Sciences (4 mentions)
Ripa buffer, by Thermo Fisher Scientific (4 mentions)
β actin, by Merck Group (4 mentions)
Clarity western ecl substrate, by Bio-Rad (4 mentions)
Ecl reagent, by Bio-Rad (4 mentions)
Immobilon western chemiluminescent hrp substrate, by Merck Group (4 mentions)
Protease inhibitor cocktail tablet, by Roche (4 mentions)
Complete protease inhibitor cocktail, by Roche (3 mentions)
Anti iκbβ, by Santa Cruz Biotechnology (3 mentions)
Ne per, by Thermo Fisher Scientific (3 mentions)
Anti gapdh, by Cell Signaling Technology (3 mentions)
188 protocols using immobilon membrane
1
Western Blot Analysis of Signaling Proteins
2
RT-PCR and Immunoblotting for Proteases and Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription‐PCR was carried out as described elsewhere using the following primers:12 SPINT2, forward 5′‐CGGGGCAATAAGAACAGCT‐3′ and reverse 5′‐AGCTGCTCCTTGTCATCATCTCC‐3′; and β‐actin (ACTB), forward 5′‐ ATTGCCGACAGGATGCAGA ‐3′ and reverse 5′‐ GAGTACTTGCGCTCAGGAGGA ‐3′. Primer sequences for HGFA (HGFAC), matriptase (ST14), hepsin (HPN), TMPRSS2, TMPRSS13, human airway trypsin‐like protease (HAT: TMPRSS11D), HGF, MET, HAI‐1 (SPINT1), and GAPDH are described in Table S1 .
For immunoblotting, cultured cells (approximately 70% confluency) were washed 3 times with PBS and the cellular proteins were extracted with 1% (v/v) Triton X‐100 in PBS with protease inhibitor cocktail (Merck & Co., Kenilworth, NJ, USA). For immunoblotting, each extracted protein was separated by SDS‐PAGE under nonreducing conditions, transferred onto an Immobilon membrane (Millipore, Bedford, MA, USA), and processed for HAI‐2/SPINT2 detection using mouse mAb 2A6121 as described elsewhere.12 For the detection of MET and phosphorylated MET, cells were extracted in the presence of 100 mmol/L NaF and 1 mmol/L Na3VO4 and SDS‐PAGE was carried out under reducing conditions. Anti‐human MET mouse mAb was kindly provided by Dr. D. Naka, Yokohama Research Center, Mitsubishi Pharma (Yokohama, Japan), and antiphosphorylated (Tyr1234/1235) MET rabbit mAb was purchased from Cell Signaling Technology (Boston, MA, USA).
For immunoblotting, cultured cells (approximately 70% confluency) were washed 3 times with PBS and the cellular proteins were extracted with 1% (v/v) Triton X‐100 in PBS with protease inhibitor cocktail (Merck & Co., Kenilworth, NJ, USA). For immunoblotting, each extracted protein was separated by SDS‐PAGE under nonreducing conditions, transferred onto an Immobilon membrane (Millipore, Bedford, MA, USA), and processed for HAI‐2/SPINT2 detection using mouse mAb 2A6121 as described elsewhere.
3
Western Blot Protein Analysis Protocol
4
Assessing Capsid Protein Sensitivity to Trypsin
5
Western Blot Analysis of Oxidative Stress Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were separated and transferred to an Immobilon membrane (Millipore, Bedford, MA) as previously described51 (link). After electrotransfer, the filters were incubated with appropriate polyclonal antibody against 3-nitrotyrosine (Upstate Biotechnology. Lake Placid. NY), iNOS, phosphorylated Rac1, NOX2, UCP2, CHOP, PPARγ, 3-nitrotyrosine (Santa Cruz Biotechnology, Santa Cruz, CA), and β-actin (Sigma-Aldrich, Alcobendas, Spain). Signals were detected using the ECL Western Blotting Detection Reagent (Amersham Ibérica, Madrid, Spain).
6
Quantifying OXPHOS Protein Levels in Caco-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fourteen-days differentiated Caco-2 cells were washed with ice-cold HBSS, lysed, and sonicated in 50 mM TRIS-HCl (pH 7.4) supplemented with 1% Triton (Sigma Aldrich) and 10% protease inhibitor (P8340, Sigma Aldrich). Experiments were performed in triplicate. Protein concentrations were determined with the Bio-Rad DC colorimetric protein assay (Bio-Rad laboratories) according to manufacturer's protocol. Protein samples were heated at 50°C for 5 min, separated (30 μg protein per sample per lane) by SDS-PAGE using 12% polyacrylamide gels and finally transferred to an Immobilon membrane (Millipore). Five individual proteins representing the five different OXPHOS complexes (NDUFB8 for Complex I; SDHB for Complex II; UQCRC2 for Complex III; COX II for Complex IV; ATP5A for Complex V) were detected (incubation overnight at 4°C) with total anti-OXPHOS human antibody cocktail (1:1,000, Ab110411, Abcam). Anti-β-actin antibody (1:1,000, Ab8227) was used as a loading control. Bound primary antibodies were visualized using IRDye 800CW goat anti-mouse IgG secondary antibody (1:10,000; LI-COR Biosciences Inc., Lincoln, NE, USA). Blots were scanned with LI-COR's Odyssey Infrared Image System.
7
Mitochondrial Protein Analysis by SDD-AGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Semi-denaturing detergent agarose gel electrophoresis (SDD-AGE) analysis was performed as described previously13 (link). In brief, harvested cells resuspended in mitochondrial isolation buffer (Beyotime Biotechnology) were subjected to dounce-homogenization to lyse the cell. The homogenate was centrifuged at 700 × g for 10 min at 4 °C to spin out the cell debris and nucleus. The supernatant was further centrifuged at 10,000 × g for 30 min at 4 °C to pellet the intact crude mitochondria. Crude mitochondria (P5) were lysed in 1×sample buffer (0.5× TBE, 10% glycerol, 2% SDS and 0.0025% bromophenol blue) and loaded onto a vertical 1.5% agarose gel (Bio-Rad). The proteins were transferred to an Immobilon membrane (Millipore) as mentioned above for further immunoblot analysis after electrophoresis in the running buffer (0.5× TBE and 0.1% SDS) for 35 min with a constant voltage of 100 V at 4 °C.
8
Quantitative Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues lysis was carried out in RIPA buffer followed by separation through sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). The tissue lysates obtained were mixed with lamellae buffer and boiled for 5 min. This was followed by protein separation through SDS-PAGE and subsequent transfer to Immobilon membrane (Millipore). The antibodies used were anti-Phospho-ERK antibody (Boster Biological Technology, Pleasanton CA, USA, Catalog # P00030) and Smad1/2 antibody (Santa Cruz Biotechnology, Inc. Catalog # sc-7960). Incubation was done in 5% nonfat dry milk, Tris-HCL, 0.1% Tween 20 for 1 hr. This was followed by addition of primary antibodies to the membrane carrying samples and subsequent incubation at 4℃overnight. A 2-hour incubation was carried out at room temperature for secondary antibodies. The samples are washed twice in n 1 × TBS-T. Quantification of the target proteins was done by the densitometric analysis of the immunoblots against the control sample by β-actin protein normalization using Image analysis software on the ChemiDoc MP imaging system (version 3) produced by Bio-Rad (Hercules, CA).
9
Western Blot Protein Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed in PBS and lysed in boiling sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer (62.5 mM Tris (pH 6.8), 1% SDS, 10% glycerol and 5% β-mercaptoethanol). The lysates were boiled for 5 min, separated by SDS-PAGE, and transferred to an Immobilon membrane (Millipore, Bredford, MA, USA). After blocking nonspecific binding sites for 1 h using 5% skim milk, membranes were incubated for 2 h with specific Abs. Membranes were then washed three times with TBST and incubated further for 1 h with horseradish peroxidase-conjugated anti-rabbit, anti-mouse or anti-goat antibody. Visualization of protein bands was accomplished using ECL (Advansta, Menlo Park, CA, USA). The representative results from at least three independent experiments are shown.
10
Western Blot Analysis of Protein Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in RIPA buffer (Cell Signaling Technology) containing protease inhibitors. The lysate was centrifuged and the supernatant was collected. Protein concentration was determined using a BCA Protein Assay Kit (Pierce). Aliquots (30-40μg) of protein were separated on 10% SDS-PAGE electrophoresis gel and transferred to PVDF membrane (Immobilon-membrane, Millipore). After washed with Tris buffered saline Tween-20 buffer (TBST; pH 7.5; 10 mM Tris, 150 mM NaCl and 0.1% Tween 20) for 10 min x 3 times, PVDF membrane was blocked in 5% skim milk for 1 hour, then incubated overnight at 4 °C with primary antibodies (anti-β-ACTIN, anti-HIF-1α or anti-SP1; 1:1000, CST, USA). After washed three times with TBST (pH 7.5) at room temperature, the PVDF membrane was incubated for 1 hour at room temperature with the secondary antibody, then washed three times with TBST (pH 7.5) at room temperature for 10 min x 3 times. Proteins were then detected using a chemiluminescence and imaging system (Bio-Rad, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!