Truseq dna kit

Manufactured by Illumina

Sourced in United States, Hong Kong

The TruSeq DNA kit is a library preparation kit designed for high-throughput sequencing on Illumina platforms. It enables the generation of sequencing-ready DNA libraries from a range of input DNA amounts. The kit provides a streamlined workflow and reagents necessary for DNA fragmentation, end-repair, A-tailing, and adapter ligation.

Automatically generated - may contain errors

Lab products found in correlation

51 protocols using truseq dna kit

16S rRNA Gene Sequencing of Fecal Microbiota

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fecal microbiota of the patient was analyzed using 16S rRNA gene-based sequencing as described previously.[⁶ (link),⁸ (link)] In brief, genomic DNA was isolated from the studied fecal samples. Following a standard purification procedure, the concentration and the quality of the DNA samples were examined on a NanoDrop spectrophotometer (ThermoFisher Scientific, Wilmington, DE) and by agarose gel electrophoresis, respectively. The variable V3V4 regions of the 16S rRNA genes were amplified by polymerase chain reaction (PCR) using the following primers: 5’-GTACTCCTACGGGAGGCAGCA-3’ and 5’-GTGGACTACHVGGGTWTCTAAT-3’. The purified PCR products were used to prepare the sequencing library using the TruSeq DNA Kit from Illumina following the manufacturer's manual, which were subjected to gene sequencing using Reagent Kit v3 on the MiSeq sequencer (Illumina, SanDiego, CA).[⁹ (link),¹⁰ (link)] With the Quantitative Insights into Microbial Ecology (QIIME) pipeline,^[11] (link) we processed raw sequences into tags based on the overlapping relationship, and separated reads with barcodes of each studied sample with removing the reads with low quality. Subsequently, we clustered the processed tags and assigned the operational taxonomic units (OTUs) to taxa by matching to the Greengenes database.^[12] (link)

Wei Y., Li N., Xing H., Guo T., Gong H, & Chen D. (2019). Effectiveness of fecal microbiota transplantation for severe diarrhea after drug-induced hypersensitivity syndrome. Medicine, 98(52), e18476.

+ Open protocol

+ Expand

Whole Genome Sequencing of ΔsmpB::dif Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full genome sequencing of strain ΔsmpB::dif was performed by generating a library from randomly
sheared 350 bp genomic DNA fragments using a TruSeq DNA Kit (Illumina
Inc., San Diego, CA) following the manufacturer’s protocol.
Paired-end sequencing was performed for 100 cycles using an Illumina
HiSeq 2500 by the University of Minnesota Genomics Center. Approximately
1.3 GB of data was obtained representing >300-fold sequence coverage
(NCBI BioProject accession number PRJNA343132). High-quality paired-end
reads were trimmed using Cutadapt (http://cutadapt.readthedocs.io/en/stable/guide.html#trimming-paired-end-reads) and mapped to the H37Rv reference genome sequence^{40 (link)} using Geneious 6.0 (Biomatters Ltd., Auckland, New Zealand).
Sequence of the smpB region was independently verified
by sequencing of PCR amplicons covering open reading frames from Rv3098c to Rv3102c.

Alumasa J.N., Manzanillo P.S., Peterson N.D., Lundrigan T., Baughn A.D., Cox J.S, & Keiler K.C. (2017). Ribosome Rescue Inhibitors Kill Actively Growing and Nonreplicating Persister Mycobacterium tuberculosis Cells. ACS Infectious Diseases, 3(9), 634-644.

+ Open protocol

+ Expand

RNA-Seq of Zebrafish Tissues

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A single CG2 zebrafish was euthanized and the kidney, intestine, gills and spleen were dissected and combined for RNA extraction (TRIzol Reagent, Life Technologies). RNA was prepared for sequencing with the TruSeq RNA kit (Illumina) and sequenced (2 × 100 bp paired end reads) on a single lane of a HiSeq2000 (Illumina). In an effort to detect rare transcripts, a normalization procedure also was employed. Normalized cDNA was achieved with the MINT-Universal cDNA synthesis and TRIMMER-DIRECT cDNA normalization kits (Evrogen) which was then prepared for sequencing with the TruSeq DNA kit (Illumina). The normalized library was sequenced (2 × 100 bp paired end reads) on a single HiSeq2000 lane. The Trinity Assembler (Grabherr et al. 2011 (link); Haas et al. 2013 (link)) was used to create a de novo transcriptome assembly from the raw RNA-seq data, and the transcriptome was formatted into a BLAST database using the formatdb command for the stand-alone NCBI BLAST software. Raw sequence data has been deposited in the NCBI short read archives (SRA) with accession number SRP057116, and the assembled transcriptomes are available for BLAST searches (http://www4.ncsu.edu/~jayoder/).

Dirscherl H, & Yoder J.A. (2015). A nonclassical MHC class I U lineage locus in zebrafish with a null haplotypic variant. Immunogenetics, 67(9), 501-513.

+ Open protocol

+ Expand

Soil Microbiome DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Soil total genomic DNA was extracted from 0.5 g of soil sample using a PowerSoil Total DNA Isolation Kit (MoBio Labs, Solana Beach, CA, USA) according to the manufacturer’s instruction. DNA concentration and quality were checked using a NanoDrop spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA). Extracted DNA was diluted to 10 ng/μL and stored at −40 °C for downstream use.
The primer pair 515F (5’-GTGCCAGCMGCCGCGG-3’) and reverse primer 907R (5’-CCGTCAATTCMTTTRAGTT-3’) with unique 6 nt barcode was used to amplify the hypervariable V4 region [19 (link)]. The sequencing samples were prepared using TruSeq DNA kit (Illumina, San Diago, CA, USA) according to manufacturer’s instructions. The purified library was diluted, denatured, re-diluted, mixed with PhiX (equal to 30% of final DNA amount) as described in the Illumina library preparation protocols, and then applied to a Miseq system (Illumina, San Diago, CA, USA) for sequencing with the Reagent Kit v2 2 × 250 bp (Illumina, San Diago, CA, USA) as described in the manufacturer’s manual.

Li G, & Wu C. (2017). Effects of Short-Term Set-Aside Management Practices on Soil Microorganism and Enzyme Activity in China. International Journal of Environmental Research and Public Health, 14(8), 913.

+ Open protocol

+ Expand

Gut Microbiome DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from stools using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocols. After quality checking (Qubit, Thermo Fisher Scientific, Singapore), the isolated DNA was prepared for library construction (TruSeq DNA kit, Illumina, San Diego, CA, United States) with an insert size of 350 bases. The qualified libraries were then paired-end sequenced as 150 (nt) reads using the HiSeq platform (Illumina, San Diego, CA, United States).

Li D., Li Y., Dai W., Wang H., Qiu C., Feng S., Zhou Q., Wang W., Feng X., Yao K., Liu Y., Yang Y., Yang Z., Xu X., Li S., Wei J, & Zhou K. (2019). Intestinal Bacteroides sp. Imbalance Associated With the Occurrence of Childhood Undernutrition in China. Frontiers in Microbiology, 10, 2635.

+ Open protocol

+ Expand

DNA Fragmentation and Sequencing Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA (500 ng) was fragmented through sonication using a Covaris S220 instrument (Covaris, Woburn, MA, USA) and DNA‐seq libraries were generated using the TruSeq DNA kit according to the manufacturer's instructions (Illumina, San Diego, CA, USA). Library length was assessed by capillary electrophoresis on a 2200 TapeStation (Agilent Technologies) and quantified by qPCR using primers annealing to the adapter sequences. DNA‐seq libraries were sequenced on an Illumina HiSeq1000 platform and generating 100‐bp paired‐end reads for a total of 2.5 Gb.

Cecchin M., Marcolungo L., Rossato M., Girolomoni L., Cosentino E., Cuine S., Li‐Beisson Y., Delledonne M, & Ballottari M. (2019). Chlorella vulgaris genome assembly and annotation reveals the molecular basis for metabolic acclimation to high light conditions. The Plant Journal, 100(6), 1289-1305.

+ Open protocol

+ Expand

Genomic DNA Library Preparation and Variant Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA library preparation was performed as in Wildenberg and Murray (2014) (link) with an Illumina Truseq DNA kit on a Illumina Hiseq 2000 with 150 base paired end reads (Supplementary file 1). The Burrows-Wheeler Aligner (bio-bwa.sourceforge.net) (Li and Durbin, 2009 (link)) was used to map DNA sequences to the S. cerevisiae reference genome r64, which was downloaded from Saccharomyces Genome Database (www.yeastgenome.org). The samtools software package (samtools.sourceforge.net) was then used to sort and index the mapped reads into a BAM file. GATK (www.broadinstitute.org/gatk) (McKenna et al., 2010) was used to realign local indels, and Varscan (varscan.sourceforge.net) (Koboldt et al., 2012 (link)) was used to call variants. Mutations were found using a custom pipeline written in Python (www.python.org) using the Biopython (biopython.org) and pysam (github.com/pysam-developers/pysam) modules. The pipeline (github.com/koschwanez/mutantanalysis) (Koschwanez et al., 2013 (link)) compares variants between the reference strain, the ancestor strain, and the evolved strains. A variant that occurs between the ancestor and an evolved strain is labeled as a mutation if it either (1) causes a non-synonymous substitution in a coding sequence or (2) occurs in a promoter region, defined as 500 bp upstream of the coding sequence.

Laan L., Koschwanez J.H, & Murray A.W. (2015). Evolutionary adaptation after crippling cell polarization follows reproducible trajectories. eLife, 4, e09638.

+ Open protocol

+ Expand

Methylated DNA Purification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sperm and spermatid chromatin were separated as described above, and 200 ng of digested genomic DNA were used to purify methylated DNA using the Methyl Collector TM Ultra Kit (Active Motif, #55005). The purification was carried out according to the manufacturer's instructions, using the low salt buffer to wash the bead-methyl DNA complexes. The purified methylated DNA and the input DNA were then subjected to library preparation with the TruSeq DNA Kit (Illumina, #FC-121-2001).

Teperek M., Simeone A., Gaggioli V., Miyamoto K., Allen G.E., Erkek S., Kwon T., Marcotte E.M., Zegerman P., Bradshaw C.R., Peters A.H., Gurdon J.B, & Jullien J. (2016). Sperm is epigenetically programmed to regulate gene transcription in embryos. Genome Research, 26(8), 1034-1046.

+ Open protocol

+ Expand

Bacterial and Fungal Diversity Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA was extracted from the soybean paste samples with the Illumina Truseq DNA kit following the manufacturer's instructions. The purity of the genomic DNA was confirmed by 1% agarose gel electrophoresis. Primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were designed according to the V3–V4 region of bacterial 16S rRNA gene. Primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC) were designed based on the ITS1F‐ITS2R region of the fungal internal transcribed spacer (Li, Tang, et al., 2019 (link); Li, Zou, et al., 2019 (link)) and used the following reaction conditions: an initial denaturation at 95℃ for 3 min, followed by 35 cycles at 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 45 s and a final 10 min extension at 72℃. The PCR product was sequenced by Shanghai Majorbio Bio‐pharm Technology Co., Ltd.

Li S., Du X., Feng L., Mu G, & Tuo Y. (2021). The microbial community, biogenic amines content of soybean paste, and the degradation of biogenic amines by Lactobacillus plantarum HM24. Food Science & Nutrition, 9(12), 6458-6470.

+ Open protocol

+ Expand

Transcriptomic Profiling of Primed T Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA sequencing was conducted with nCD4 + T_N, T_SCM and T_CM cells from 4 healthy human donors. Additionally, TWS119- and rapamycin-induced T_SCM cells were resorted after 14 days of nCD4 + T_N cell priming from the same donors. RNA was purified with Arcturus PicoPure RNA Isolation kit (Biosystems/Applied Life Technologies). An amount of 10 ng total RNA was amplified with the SMARTer Ultra Low RNA Kit for Illumina Sequencing (Clontech Laboratories, Inc.) and the Advantage 2 PCR Kit (Clontech Laboratories, Inc.). The cDNA from the amplification reactions was sheared with a Covaris ultrasonicator (Covaris, Inc.) and sequencing libraries were generated with a Truseq DNA kit (Illumina, Inc.). Libraries were sequenced at 100 nucleotides single read mode on an Illumina HiSeq 2000 instrument.

Scholz G., Jandus C., Zhang L., Grandclément C., Lopez-Mejia I.C., Soneson C., Delorenzi M., Fajas L., Held W., Dormond O, & Romero P. (2016). Modulation of mTOR Signalling Triggers the Formation of Stem Cell-like Memory T Cells. EBioMedicine, 4, 50-61.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!