Log In Sign up
The largest database of trusted experimental protocols

Mirus transit lt1

Manufactured by Mirus Bio
Visit Supplier
Sourced in United States

The Mirus TransIT-LT1 is a cationic lipid-based transfection reagent designed for the delivery of nucleic acids, such as plasmid DNA, into a variety of mammalian cell lines. It facilitates the efficient and gentle transfection of genetic material into cells, enabling researchers to study gene expression, protein production, and other cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Endofree maxiprep kit, by Qiagen (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Synergy mx, by Agilent Technologies (2 mentions) Hiperfect, by Qiagen (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Opti mem reduced serum medium, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions) Newborn calf serum, by Atlanta Biologicals (1 mentions) Cycloheximide (chx), by Merck Group (1 mentions) Tnf α, by Merck Group (1 mentions) Sb431542, by Selleck Chemicals (1 mentions) Tgf β1, by Merck Group (1 mentions) Hek293t c17, by American Type Culture Collection (1 mentions) Polybrene, by Merck Group (1 mentions) Steriflip filter, by Merck Group (1 mentions) Pspax2, by Addgene (1 mentions) Pmd2 g, by Addgene (1 mentions) High glucose, by Merck Group (1 mentions)

21 protocols using mirus transit lt1

1

Lentiviral Transduction of Murine Lung Tumors

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviral backbone Lenti-LucOS has been described previously (DuPage et al., 2011 (link)). Lentiviral plasmids and packaging vectors were prepared using endo-free maxiprep kits (QIAGEN). The pGK::GFP-LucOS::EFS::FlpO lentiviral plasmid was cloned using Gibson assembly (Akama-Garren et al., 2016 (link); Gibson et al., 2009 (link)). Briefly, GFP-OS was created as a protein fusion of GFP and ovalbumin257-383, which includes the SIINFEKL and AAHAEINEA epitopes, and SIYRYYGL antigen. Lentiviral plasmids and packaging vectors were prepared using endo-free maxiprep kits (QIAGEN). Lentiviruses were produced by co-transfection of 293FS* cells with Lenti-LucOS or FlpO-GFP-OS, psPAX2 (gag/pol), and VSV-G vectors at a 4:3:1 ratio, respectively, with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel). Virus was then resuspended in 1:1 Opti-MEM (GIBCO) - HBSS. Aliquots of virus were stored at −80°C and titered using the GreenGo 3TZ cell line (Sánchez-Rivera et al., 2014 (link)).
For tumor induction, mice between 8-15 weeks of age received 2.5 × 104 PFU of Lenti-LucOS or 4.5 × 104 PFU of FlpO-GFP-OS intratracheally as described previously (DuPage et al., 2009 (link)).
Li A., Herbst R.H., Canner D., Schenkel J.M., Smith O.C., Kim J.Y., Hillman M., Bhutkar A., Cuoco M.S., Rappazzo C.G., Rogers P., Dang C., Jerby-Arnon L., Rozenblatt-Rosen O., Cong L., Birnbaum M., Regev A, & Jacks T. (2019). IL-33 Signaling Alters Regulatory T Cell Diversity in Support of Tumor Development. Cell reports, 29(10), 2998-3008.e8.
+ Open protocol
+ Expand
2

Maintenance and Transfection of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were maintained in 50% DMEM/50% Ham’s F-12 medium containing 10% FBS, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin (complete medium). HeLa cells were cultured in DMEM with the same supplements. MEF cells from WT and β-­arrestin-1/2 double-knockout mice were obtained from Robert Lefkowitz (Duke University) and maintained in DMEM with the same supplements. PM1, HuT 78, and NC-37 cells were obtained from the NIH AIDS Reagent Program and maintained in RPMI 1640 with the same supplements except that FBS was added at 20% for HuT 78. In some experiments, the tissue culture plates were coated with poly-l-lysine before plating cells. Transient transfection of plasmids was performed using Mirus TransIT-LT1 (Mirus Bio) according to the manufacturer’s instructions. For MEF cells, expression of GPR15 was achieved by retroviral transfer of pBabe-puro vectors encoding GPR15.
Okamoto Y, & Shikano S. (2017). Differential phosphorylation signals control endocytosis of GPR15. Molecular Biology of the Cell, 28(17), 2267-2281.
+ Open protocol
+ Expand
3

Notum Protein Overexpression Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids (Notum wild-type and Notum S239A mutant) are described elsewhere.(11 (link)) Cells were seeded at 70% confluence in 6-well plates and transfected with plasmids (Empty vector, NTM WT and NTM S239A) (2μg) using either Lipofectamine 2000 (Invitrogen) or Mirus TransIT-LT1 (Mirus) for 48 hours and transferred to 24-well plates for further assay. Mouse recombinant Notum protein was synthesized and provided by Indiana Biomedical Research Institute (IBRI).
Choi R.B., Bullock W.A., Hoggatt A.M., Horan D.J., Pemberton E.Z., Hong J.M., Zhang X., He X, & Robling A.G. (2021). Notum deletion from late-stage skeletal cells increases cortical bone formation and potentiates skeletal effects of sclerostin inhibition. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 36(12), 2413-2425.
+ Open protocol
+ Expand
4

Transfection of SPCS1 Huh 7.5 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
12-well plates were seeded with SPCS1(-) or SPCS1(+) Huh 7.5 cells in DMEM containing 10% fetal bovine serum (FBS, Gibco) and transfected with 1 μg of plasmid once cells reached 90–100% confluency, using Mirus TransIT-LT1 (Mirus) or Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions. In brief, a mixture of plasmid DNA, Mirus TransIT-IL1 or Lipofectamine 3000 reagent, and Opti-MEM reduced serum medium (Gibco) was incubated according to manufacturer’s instructions with the following modifications: transfection mixture was incubated for 20 mins at room temperature, then added to cells in a drop-wise manner.
Alzahrani N., Wu M.J., Sousa C.F., Kalinina O.V., Welsch C, & Yi M. (2022). SPCS1-Dependent E2-p7 processing determines HCV Assembly efficiency. PLoS Pathogens, 18(2), e1010310.
+ Open protocol
+ Expand
5

Lentiviral Induced Lung Tumor Modeling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviral backbone Lenti-LucOS has been described previously(DuPage et al., 2009 (link)). Lentiviral plasmids and packaging vectors were prepared using endo-free maxiprep kits (Qiagen). Lentiviruses were produced by co-transfection of 293FS* or 293T cells with Lenti-LucOS, psPAX2 (gag/pol), and VSV-G vectors at a 4:3:1 ratio, respectively, with Mirus TransIT LT1 (Mirus Bio, LLC). Virus-containing supernatant was collected 48 and 72h after transfection and filtered through 0.45mm filters before concentration by ultracentrifugation (25,000 RPM for 2 hours with low decel). Virus was then resuspended in 1:1 Opti-MEM (Gibco) HBSS. Aliquots of virus were stored at −80°C and titered using the GreenGo 3TZ cell line.
For tumor induction, mice between 10-16 weeks of age received 2.5 x104 PFU of Lenti-LucOS intratracheally as described previously (DuPage et al., 2009 (link)).
Schenkel J.M., Herbst R.H., Canner D., Li A., Hillman M., Shanahan S.L., Gibbons G., Smith O.C., Kim J.Y., Westcott P.M., Hwang W.L., Freed-Pastor W.A., Eng G., Cuoco M.S., Rogers P., Park J.K., Burger M.L., Rozenblatt-Rosen O., Cong L., Pauken K.E., Regev A, & Jacks T. (2021). Conventional type I dendritic cells maintain a reservoir of proliferative tumor-antigen specific TCF-1+ CD8+ T cells in the tumor draining lymph nodes. Immunity, 54(10), 2338-2353.e6.
+ Open protocol
+ Expand
6

Mouse Embryonic Fibroblast Maintenance and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse embryonic fibroblast (MEF) and HeLa cell lines were maintained at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM; HyClone) supplemented with 10% newborn calf serum (Atlanta Biologicals), 1% penicillin/streptomycin, and 1% glutamine. The MEF cell lines MEFC20 (Rad51d+/+Trp53−/−), MEF258 (Rad51d−/−Trp53−/−), M7 (Rad51d+/+Trp53+/+), and MEF172AG (Rad51d−/−Trp53−/−HARad51d) were described previously [25 (link)]. Plasmid constructs were transfected using Lipofectamine Reagents (Invitrogen) or Mirus TransIT-LT1 according to manufacturer’s instructions. Ten micrograms per milliliter cycloheximide (Sigma) was used for protein stability experiments.
Yard B.D., Reilly N.M., Bedenbaugh M.K, & Pittman D.L. (2016). RNF138 interacts with RAD51D and is required for DNA interstrand crosslink repair and maintaining chromosome integrity. DNA repair, 42, 82-93.
+ Open protocol
+ Expand
7

NF-κB Transactivation Assay with Strebloside

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were plated at a density of 25,000 per well into 24-well plates and incubated overnight. Cells were transfected with 0.05 μg/well of an expression construct containing the NF-κB binding element promoter upstream of the luciferase gene using Mirus TransIT LT1 (Mirus Bio LLC, Madison, WI, USA), according to the manufacturer’s instructions. Cells were transfected for 24 h in serum-supplemented medium. Cells were then treated with TNFα at 10 ng/mL (Sigma Aldrich), and (+)-strebloside (100 nM) or digitoxin (100 nM) for 4 h. Normal cell luciferase activity was measured using a Synergy Mx (BioTek).
Chen W.L., Ren Y., Ren J., Erxleben C., Johnson M.E., Gentile S., Kinghorn A.D., Swanson S.M, & Burdette J.E. (2017). (+)-Strebloside-induced Cytotoxicity in Ovarian Cancer Cells is Mediated through Cardiac Glycoside Signaling Networks. Journal of natural products, 80(3), 659-669.
+ Open protocol
+ Expand
8

Smad-Responsive Luciferase Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were plated at a density of 25,000 per well into 24-well plates and incubated overnight. Cells were transfected with 0.05 μg/well of an expression construct containing the Smad binding element promoter upstream of the luciferase gene using Mirus TransIT LT1 (Mirus Bio LLC, Madison, WI) according to the manufacturer's instructions. The Smad responsive element plasmid contains a CAGA sequence repeated twelve times upstream of the luciferase gene (gift from Dr. Aris Moustakas at Ludwig Institute for Cancer Research, Uppsala, Sweden). Plasmids for expression of wild-type p53 or mutant p53 R273H plasmids were transfected into cells at 0.05 μg/mL. Cells were transfected for 24 hr in serum-supplemented media. Cells were then washed with PBS and treated with TGFβ1 at 10 ng/mL (Sigma Aldrich) for 24 hr. SB-431542 (Selleck Chemicals, Houston, TX) was used at a concentration of 5 μM for all luciferase assays. The protocol and SBE-luciferase transfection efficiencies were normalized and run as previously described [28] (link). Normal cell luciferase activity was measured using a Synergy Mx (BioTek, Winooski, VT).
Ó hAinmhire E., Quartuccio S.M., Cheng W., Ahmed R.A., King S.M, & Burdette J.E. (2014). Mutation or Loss of p53 Differentially Modifies TGFβ Action in Ovarian Cancer. PLoS ONE, 9(2), e89553.
+ Open protocol
+ Expand
9

Plasmid and siRNA Transfection Procedure

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with the plasmids or siRNAs (40 nM at final concentration) by Mirus TransIT-LT1 (Mirus Bio LLC, Madison, WI, USA) or HiperFect (Qiagen, Dusseldorf, Germany) according to the manufacturer’s instructions, respectively. The plasmid coding siRNA-resistant GFP-fused DHX9 was constructed by introducing mutations into wild-type DHX9 with the primers: (1) TAAACGAGCGATGCTGAACATGATCCGTCAGA and (2) GCATGCGCTCGTTTACGGGGTCCAACTGGCTGA. See Table S1 for the siRNAs used in this study.
Matsui M., Sakasai R., Abe M., Kimura Y., Kajita S., Torii W., Katsuki Y., Ishiai M., Iwabuchi K., Takata M, & Nishi R. (2020). USP42 enhances homologous recombination repair by promoting R-loop resolution with a DNA–RNA helicase DHX9. Oncogenesis, 9(6), 60.
+ Open protocol
+ Expand
10

Lentiviral-mediated JunD knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
To disrupt JunD expression, shRNAs from The RNAi Consortium (TRC) were screened for knockown potential in SW480 cells by transient transfection of purified plasmid using Mirus TransIT-LT1 (Mirus Bio, Madison, WI) followed by western blotting to monitor JunD expression (MAB5526 antibody; R&D Systems, Minneapolis, MN). TRC clone TRCN0000014975 was found to reduce JunD expression to the greatest extent (data not shown) and was used in subsequent experiments. Lentiviral plasmids were co-transfected with packaging vectors psPAX2 (Addgene plasmid #12260; a gift from Didier Trono) and pMD2.G (Addgene plasmid #12259; a gift from Didier Trono) into HEK293T/c17 cells (ATCC) using Mirus TransIT-Lenti. Virus-containing medium was collected 48 h after transfection and cleared of potential cells using 0.45-μm Steriflip filters (MilliporeSigma). Virus-containing media were mixed with Polybrene (MilliporeSigma) for transduction. Expression of JunD was assessed using the MAB5526 antibody. Scramble control shRNA on the same vector backbone (pLKO.1-puro non-target control shRNA; MilliporeSigma) was used as a control.
Ghaffari S., Hanson C., Schmidt R.E., Bouchonville K.J., Offer S.M, & Sinha S. (2021). An integrated multi-omics approach to identify regulatory mechanisms in cancer metastatic processes. Genome Biology, 22, 19.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!