Two-cell-stage ICR embryos were collected at 1.5 d.p.c. by flushing of the oviducts in M2 medium (Sigma). The embryos were cultured to the morula stage in M16 medium (Sigma), and the zona pellucida was then removed by acidic Tyrode’s solution at the morula stage. One diploid morula-stage embryo and dispersed TESCs (10–15 cells) were aggregated in the bottom of a culture dish in a well created with a needle (DN-9, Biological Laboratory Equipment Maintenance and Service Ltd., Budapest, Hungary). The aggregated embryos were washed and cultured to the blastocyst stage in M16 medium (Sigma) in a humidified atmosphere of 5% CO2 in air at 37°C.
M16 medium
Manufactured by Merck Group
Sourced in United States
M16 medium is a culture medium used for the isolation and cultivation of microorganisms. It provides the necessary nutrients and growth factors for the growth and maintenance of microbial cultures in a laboratory setting.
Automatically generated - may contain errors
Lab products found in correlation
M2 medium, by Merck Group (60 mentions)
Hyaluronidase, by Merck Group (16 mentions)
Mineral oil, by Merck Group (14 mentions)
Human chorionic gonadotropin (hcg), by Merck Group (12 mentions)
Lsm 780 confocal microscope, by Zeiss (6 mentions)
Serotropin, by Aska Pharmaceutical (4 mentions)
M7167, by Merck Group (4 mentions)
M5310, by Merck Group (4 mentions)
Pronase, by Merck Group (4 mentions)
Pregnant mare serum gonadotropin, by Merck Group (4 mentions)
Gonatropin, by Aska Pharmaceutical (3 mentions)
Milrinone, by Merck Group (3 mentions)
M7292, by Merck Group (3 mentions)
Ksom medium, by Merck Group (3 mentions)
Bovine serum albumin (bsa), by Merck Group (3 mentions)
3 isobutyl 1 methylxanthine ibmx, by Merck Group (3 mentions)
M2 solution, by Merck Group (2 mentions)
3 isobutyl 1 methyl xanthine (ibmx), by Merck Group (2 mentions)
4 6 diamidino 2 phenylindole (dapi), by Vector Laboratories (2 mentions)
Ro4929097, by Selleck Chemicals (2 mentions)
147 protocols using m16 medium
1
Diploid Morula-Stage Embryo Aggregation
2
Knockdown of CBS expression in GV oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The COCs were cultured at 37°C with 5% CO2 for 1 h in the MEM alpha (1×) medium containing 3.33 μM milrinone (Sigma) and 10% FBS to be arrested at GV stage. The GV‐intact oocytes were microinjected with 10 pl of 1 mM Cbs morpholino oligo (5′‐ATTTTCAGAGGGAGCGAAGACCT‐3′, Gene Tools) to knockdown CBS expression or 10 pl of 1 mM standard control oligo (5′‐CCTCTTACCTCAGTTACAATTTATA‐3′, Gene Tools) as a Control group. GV oocytes without microinjection were designated as the Uninjected group. Oocytes were cultured for 24 h in M16 medium (Sigma) containing 3.33 μM milrinone and washed in milrinone‐free MEM (1×) + GlutaMAX‐I. Then they were transferred to M16 medium without milrinone and incubated for 0, 8, and 17 h for immunofluorescence and western blot.
3
GV Oocyte Collection and Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Germinal vesicle (GV) oocyte collection and culture: 6–8‐week‐old ICR female mice were intraperitoneal injection of 10 IU of pregnant mare serum gonadotropin (PMSG, dissolved in PBS; 100 μl per mice); after 48 h, cumulus‐oocyte complexes (COCs) were isolated from ovaries in M 2 medium, then clear the cumulus cells away from COCs by repeated mouth‐controlled pipetting. The oocytes were then cultured with M 16 medium (Sigma Aldrich) under mineral oil at 37°C in 5% CO2.
PHE was dissolved in DMSO to prepare a 50 mM stock solution and then diluted in M 16 medium at different concentrations for experiments. Based on the effect of PHE on GVBD and first polar body extrusion of MI oocytes, 400 μM was chose for the following experiments.
Metaphase II (MII) collection and culture: 5 IU human chorionic gonadotrophin (HCG) was injected at 48 hours after PMSG injection. After 13–14 h, female mice were super‐ovulated, and MII oocytes were collected from ampulla of the oviduct.
PHE was dissolved in DMSO to prepare a 50 mM stock solution and then diluted in M 16 medium at different concentrations for experiments. Based on the effect of PHE on GVBD and first polar body extrusion of MI oocytes, 400 μM was chose for the following experiments.
Metaphase II (MII) collection and culture: 5 IU human chorionic gonadotrophin (HCG) was injected at 48 hours after PMSG injection. After 13–14 h, female mice were super‐ovulated, and MII oocytes were collected from ampulla of the oviduct.
4
Generation of Mouse Diploid Parthenogenic Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse diploid parthenogenic embryos were generated as previously described with slight modifications [21 ,22 ]. Eight–12-week-old female B6D2F1 (C57BL/6 × DBA/2) (Japan SLC, Inc.) were injected with 5 IU pregnant mare serum gonadotropin (PMSG, ASKA Animal Health) followed by injection with 5 IU human chorionic gonadotropin (hCG, ASKA Pharmaceutical) 46–48 h later, and matured oocytes were obtained from oviducts 16 h later. Oocytes were treated with 0.1% hyaluronidase (Sigma-Aldrich) in M2 medium (Sigma-Aldrich) for 1 min to remove cumulus cells, washed with M2 medium and M16 medium (Sigma-Aldrich) three times each, and incubated in M16 medium supplemented with 2 mM EGTA (EGTA-M16) for 20 min. Diploid parthenogenetic embryos were produced by treating the oocytes with 2 mM SrCl2 in EGTA-M16 in the presence of 5 µg/mL cytochalasin B (Wako) for 2.5 h, and then incubating them in KSOM medium (MTI-GlobalStem) in the presence of the same concentration of cytochalasin B for 3.5 h. Activated diploid parthenogenetic embryos were then washed with KSOM three times and cultured in the same medium at 37°C with 5% CO2. In case diploid embryos were converted to tetraploid after parthenogenesis, E1.5 embryos were treated with 5 µg/mL cytochalasin B for 12 h to block the second cleavage, and washed three times with KSOM.
5
Murine Oocyte and Embryo Microinjection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovaries were excised and transferred into M2 medium (Merck) containing 0.1 mM 3-isobutyl-1-methylxanthine (IBMX, Merck) to keep immature oocytes. Germinal vesicle (GV) stage oocytes were isolated and subsequently cultured at 37 °C in 5% CO2 in M16 medium (Merck) with IBMX, covered with mineral oil (Merck or YBUX) for at least 1 hour prior to microinjection. Zygotes and 2-cell embryos were isolated from oviducts 18–21 and 45–47 hours post hCG stimulation in M2 medium (Merck) and subsequently cultured in KSOM + AA (Caisson Laboratories) covered with mineral oil (Merck or YBUX) at 37 °C, 5% CO2. For removing of the cumulus cells was used 0.05% hyaluronidase from bovine testes (Merck). Microinjection was performed in M2 medium with (oocytes) or without (embryos) IBMX inhibitor using I10 Narishige microinjector on a Leica DM IL inverted microscope. After microinjection were oocytes (M16 medium + IBMX, Merck) and embryos (KSOM + AA, Caisson Laboratories) cultured for cRNA expression for 1 to 3 hours prior to live cell imaging assay (37 °C, 5% CO2).
6
Nanoblades Microinjection of Mouse Zygotes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four or five weeks old FVB/NRj female mice (Janvier Labs, France) were superovulated by intraperitoneal (i.p.) administration of 5 IU of pregnant mare serum gonadotropin (PMSG, Alcyon, France), followed by an additional i.p. injection of 5 IU human chorion gonadotropin 48 h later (hCG, Alcyon, France). Superovulated females were mated with B6D2F1 adult males (1 male/2 females) and euthanatized at 0.5 day post coitum (usually between 10 and 11 a.m.). Oviduct were dissected, and the ampulla nicked to release zygotes associated with surrounding cumulus cells into a 200 µl droplet of hyaluronidase (Sigma) in M2 solution (300 µg/ml, Sigma) under a stereomicroscope (Olympus SZX9). Zygotes were incubated for 1 min at room temperature and passed with a mouth pipette through three washes of M2 medium to remove cumulus cells. Zygotes were kept in M16 medium (Sigma) in a water jacketed CO2 incubator (5% CO2, 37 °C) until microinjection with Nanoblades. Micro-injection were carried-out under a stereomicroscope (Olympus SZX9) using a FemtoJet 4i (Eppendorf) microinjecter. Briefly, 1 pl of Nanoblades were injected in the perivitelline space of oocytes. Zygotes were then transferred into M16 medium and kept overnight in incubator. The embryos that reached the two-cell stage were transferred into the oviduct of B6CBAF1 (Charles River, France) pseudopregnant females (15–20 embryos per female).
7
Giemsa Staining of Mouse Oocyte Chromosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovaries collected from 4-week-old female mice were used after 46 to 48 h of treatment with 5 IU of pregnant mare serum gonadotropin. GV oocytes were isolated by puncturing the follicles in M2 medium (Sigma MR-015). The GV oocytes were cultured in M16 medium (Sigma MR-016) in a 5% CO2 atmosphere at 37°C for 6h. For Giemsa staining of metaphase chromosome spread, oocytes were exposed to 0.5% Pronase (MERCK 10165921001) to remove the zona pellucida, and treated in hypotonic buffer containing 1% sodium citrate/0.1% PVA for 15min. The oocytes and oocyte-like cells were placed on the slides, fixed in the Carnoy’s Fixative (75% Methanol, 25% Acetic Acid), and stained in 3% Giemsa solution for 30min.
8
Isolation and Manipulation of Mouse Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fully grown GV-stage oocytes were isolated from the ovaries of C57BL/6 female mice following hormonal priming with 7.5 IU of pregnant mare serum gonadotrophin (Intervet). Oocytes were handled in a Petri dish containing prewarmed M2 medium (Sigma-Aldrich) at 37°C supplemented with 100 µM of the phosphodiesterase inhibitor, IBMX (Sigma-Aldrich), which prevents oocytes from undergoing GVBD. Only fully grown cumulus-covered oocytes with clearly identifiable GVs were used in experiments. Surrounding cumulus cells were mechanically denuded using mouth pipetting. To enable maturation, denuded GV-stage oocytes were washed through multiple droplets of M16 medium (Sigma-Aldrich) to remove all traces of IBMX. For longer-term culture, groups of oocytes were placed in dishes containing M16 microdroplets covered with mineral oil (Sigma-Aldrich) and incubated at 37°C in an atmosphere of 5% CO2 in air.
DNA DSBs were induced by incubating oocytes in M16 medium containing either Eto (Sigma-Aldrich; 10 µg/ml) or doxorubicin (Hospira; 10 µg/ml) for 3 h or by exposure to UV-B radiation via a UV transilluminator (Vilber Lourmat; 312 nm) for 5 s. ROS production was attenuated by incubating oocytes overnight in M16 medium supplemented with NAC (5 mM; Abcam 139476). The 26S proteasome inhibitor, MG132 (SelleckChem; 5 µM), was used to inhibit proteolysis as described previously (Wei et al., 2018 (link)).
DNA DSBs were induced by incubating oocytes in M16 medium containing either Eto (Sigma-Aldrich; 10 µg/ml) or doxorubicin (Hospira; 10 µg/ml) for 3 h or by exposure to UV-B radiation via a UV transilluminator (Vilber Lourmat; 312 nm) for 5 s. ROS production was attenuated by incubating oocytes overnight in M16 medium supplemented with NAC (5 mM; Abcam 139476). The 26S proteasome inhibitor, MG132 (SelleckChem; 5 µM), was used to inhibit proteolysis as described previously (Wei et al., 2018 (link)).
9
Differential Staining of Blastocyst Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells in the trophectoderm (TE) and inner cell mass (ICM) of the blastocysts were counted after differential staining of the nuclei as described in previous study[16 (link)]. The zona-free blastocysts were incubated for 10 min at 5°C in M16 medium (Sigma) containing 10 mM trinitrobenzenesulphonic acid, 4.0 mg/ml polyvinylpyrrolidone, and 0.015% Triton X-100. After washing in M2 medium (Sigma), the blastocysts were incubated in 0.1 mg/ml anti-dinitrophenol-BSA at 37°C for 15 min and washed three more times with the M2 medium. The blastocysts were then incubated in M2 medium containing a 1:10 dilution of guinea pig complement serum (Sigma) and 10.0 μg/ml propidium iodide (Sigma) at 37°C for 15 min and washed three times with Dulbecco PBS (Gibco). After fixing in absolute ethanol containing 22.0 μg/ml bisbenzimide (Sigma) at 5°C overnight, individual blastocysts were mounted in glycerol on microscope slides to inflate the dehydrated embryos and compressed manually before visualization by epi-fluorescence using the Nikon filter blocks UV-2A and G-2A. The trophectoderm exhibit fluorescence in red and the inner cell mass in blue; the cell numbers in the two areas of the embryos were counted.
10
Effects of Citrinin Toxin on Mouse Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Germinal vesicle stage oocytes were harvested from mouse ovaries. Citrinin toxin was dissolved in dimethyl sulfoxide (DMSO) for storage. For the treatment experiments, the GV oocytes were cultured in 5-10 μM Cirinin toxin in M16 medium (Sigma) at 37°C in a humidified atmosphere with 5% CO2. The concentration of citrinin toxin was adopted according to the previous study [20 (link)]. The control oocytes were cultured in M16 with the same concentration of DMSO. After culture for different time, the oocytes were collected for the experiments. For embryo collection and culture, we injected PMSG for 48 hours, and then the female mice were injected with hCG and mated with male mice. Zygotes were collected after 16 h and cultured in KSOM medium (Chemicon) under paraffin oil at 37 degree and 5% CO2. Embryos were collected for immunostaining after different times in culture.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!