ISH was used to evaluate the functions of the autophagy-related gene BxATG8. For ISH, the DNA fragment used as the probe was amplified from the full-length cDNA clones of BxATG8 with a specific primer pairs, BxATG8-I-F and BxATG8-I-R (Table 1 ). The DIG-labeled sense random primer and anti-sense cDNA probes were synthesized from BxATG8’ PCR products. The nematodes were pre-treated before the post-hybridization washing step according to the manufacturer’s instructions. Hybridization and detection were performed with the DIG-High Prime DNA Labelling and Detection Starter Kit I (Roche Diagnostics, Mannheim, Germany), and finally examined using a Zeiss Axio Image M2 microscope (Zeiss MicroImaging GmbH, Oberkochen, Germany).
Dig high prime dna labelling and detection starter kit 1
Manufactured by Roche
Sourced in Germany
The DIG High Prime DNA Labelling and Detection Starter Kit I is a laboratory equipment product designed for the labeling and detection of DNA. It provides the necessary components for the incorporation of digoxigenin-labeled nucleotides into DNA probes, enabling the identification and visualization of specific DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Hybond, by Cytiva (2 mentions)
Positively charged nylon membrane, by Roche (2 mentions)
Axioimage m2 microscope, by Zeiss (1 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (1 mentions)
Oligonucleotide, by Sangon (1 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Difco potato dextrose agar, by BD (1 mentions)
Hygromycin b, by Solarbio (1 mentions)
Hybond n membrane, by Cytiva (1 mentions)
Hybond n, by Bio-Rad (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
10 protocols using dig high prime dna labelling and detection starter kit 1
1
Evaluation of BxATG8 Autophagy Gene
2
Southern Blot Analysis of CHS Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of V592 and all the CHS deletion mutants was isolated and subjected to Southern blot analyses using the DIG High Prime DNA Labelling and Detection Starter Kit I (Roche), following the instructions provided by the manufacturer. Briefly, 20 μg of genomic DNA from V592 and all of the CHS mutants was isolated and digested with the indicated restriction enzymes (HindIII and NcoI for Vdchs1, HindIII and BamHI for Vdchs2, BamHI for Vdchs3, KpnI and PstI for Vdchs4, ApaI for Vdchs5, KpnI and PacI for Vdchs6, BsaI for Vdchs7, EcoRI and XhoI for Vdchs8). The digested DNA was separated by electrophoresis in an agarose gel and transferred onto a nylon membrane. The nylon membrane was used for hybridization and developing.
3
Molecular Cloning Reagents Specification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemicals were obtained from Sigma, Merck or Ameresco. Oligonucleotides were synthesized by Shanghai Sangon Biotech Co. Ltd (China). Taq and pfu DNA polymerases, RevertAid Reverse Transcriptase, restriction endonucleases were purchased from Fermentas or New England BioLabs. The kits used for molecular cloning were bought from Omega Bio-tek Biotechnology. Difco™Potato Dextrose Agar was from BD. Trizol was from Invitrogen Life Technologies Corporation. DIG High Prime DNA Labelling and Detection Starter Kit I was purchased from RocheApplied Science. Hygromycin B was obtained from Solarbio Science Technology Co., Ltd (China).
4
Southern Blot Analysis for Copy Number Determination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated as described above. The design of the probe and the choice of the appropriate restriction enzyme were based on the sequence of the specific vectors. The labelling system was the DIG-High Prime DNA Labelling and Detection Starter Kit I, Roche. For copy number determination [30 (link)], a total of 40 μg of DNA was digested overnight with a restriction enzyme (DraI, EcoRI or HindIII) and fractionated on a 0.8% (w/v) agarose gel and transferred to Hybond N + membrane (Amersham Biosciences, UK) according to the manufacturer’s recommendations. The membrane was hybridized at 65°C overnight with 20 ng of the labelled probe, targeting NPTII or CaMV 35 S promoter using the same primers as for PCR, and washed for 2 times 30 minutes with 0.1 × saline-sodium citrate (SSC) buffer, 0.1% (w/v) SDS at 65°C.
5
Southern Blot Analysis of E. festucae Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following restriction digestion, E. festucae genomic DNA was separated by agarose gel electrophoresis, transferred to positively charged nylon membranes (Roche) (Southern, 1975 ) and fixed by UV light cross‐linking in a Cex‐800 UV light cross‐linker (Ultra‐Lum, Claremont, California, USA) at 254 nm for 2 min. Labelling of DNA probes with digoxigenin‐dUTP (DIG), hybridization and visualization with nitroblue tetrazolium chloride and 5‐bromo‐4‐chloro‐3‐indolyl‐phosphate (NBT/BCIP) were performed using the DIG High Prime DNA Labelling and Detection Starter Kit I (Roche) according to the manufacturer's instructions.
6
Northern Blot Analysis of Plant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The probes of interested genes were labeled with digoxigenin-dUTP using DIG High Prime DNA Labelling and Detection Starter Kit I (Roche, Mannheim, Germany) according to the manufacturer’s instructions.
Forty micrograms total RNA was size-fractionated by 1.2 % (w/v) agarose gel electrophoresis containing 2.2 M formaldehyde and then transferred to a Hybond-N+ (Bio-Rad, Hercules, CA, USA) nylon membrane. The blots were hybridized with cDNA probes of interested genes (CaSQS, CabAS and CaCYS) labeled with digoxigenin-dUTP at 42 °C overnight. After hybridization, blots were washed and incubated with antibody-conjugated digoxigenin and alkaline phosphatase (1:5000 v/v) at room temperature for 30 min. The 5-bromo-4-chloro-3-indolyl-phosphate (BCIP)/nitroblue tetrazolium (NBT) (Roche, Mannheim, Germany) substrate is used for color development. The intensities of hybridization signals were analyzed using Quantity One program (ver. 4.1) of Gel Documentation System.
Forty micrograms total RNA was size-fractionated by 1.2 % (w/v) agarose gel electrophoresis containing 2.2 M formaldehyde and then transferred to a Hybond-N+ (Bio-Rad, Hercules, CA, USA) nylon membrane. The blots were hybridized with cDNA probes of interested genes (CaSQS, CabAS and CaCYS) labeled with digoxigenin-dUTP at 42 °C overnight. After hybridization, blots were washed and incubated with antibody-conjugated digoxigenin and alkaline phosphatase (1:5000 v/v) at room temperature for 30 min. The 5-bromo-4-chloro-3-indolyl-phosphate (BCIP)/nitroblue tetrazolium (NBT) (Roche, Mannheim, Germany) substrate is used for color development. The intensities of hybridization signals were analyzed using Quantity One program (ver. 4.1) of Gel Documentation System.
7
Verification of Genetic Transformations by Southern Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the integration type of targeting cassettes in transformants, Southern blot analyses were performed (Additional file 1 : Fig. S1). The mycelia were collected and genomic DNA was extracted as described previously [41 (link)]. The prepared genomic DNA (approximately 30 μg) of the OamyR, OhepA, ΔCreA, Mpga3 and 114-2 strains was digested by restriction enzymes, respectively, and then separated using agarose gel electrophoresis. Three probes were amplified for strain OamyR/OhepA, ΔCreA and Mpga3 analysis. A DIG-High Prime DNA Labelling and Detection Starter Kit I (Roche, Basel, Switzerland) was used for probe preparation, fragment hybridization, and immunological detection according to the manufacturer’s instructions. The coding region sequence of Mpga3 was amplified from the Mpga3 transformants, and the mutations were confirmed by Sanger sequencing (BGI, Shenzhen, China).
8
Overexpression of Rice NRT1.1 Transporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frames of OsNRT1.1a and OsNRT1.1b were amplified by PCR and ligated into the ubiquitin promoter of the pTCK303 vector (Figure 1 ). For OsNRT1.1a, the forward primer was 5′‐ taatggatcc CATTCTCTCGGACATTAACCT and the right primer was 5′‐taatgagctc TTCCACCACCATTATATTGC. For OsNRT1.1b, the forward primer was 5′‐taatggatcc TTGGAGCTCCACCGC and the right primer was 5′‐ taatgagctc CCCCCCCTCGAAGG.
The constructs were obtained and transformed into rice callus using Agrobacterium tumefaciens (strain EHA105), as described previously (Ai et al.2009 ). More than 15 individual T0 transgenic lines were obtained to verify the levels of OsNRT1.1a or OsNRT1.1b overexpression. Three independent lines of the T1 generation were selected from both pUbi–OsNRT1.1a (OEa1, OEa2, and OEa3) and pUbi–OsNRT1.1b (OEb1, OEb2, and OEb3) transgenic lines, while one or two copies of the T‐DNA insertion were used for further analyses. The copy numbers in the T1 generation were performed by Southern blotting (DIG High Prime DNA Labelling and Detection Starter Kit I; Roche, http://www.roche.com/index.htm ). The fragment of the coding sequences of the hygromycin genes labeled with digoxigenin was used as a probe, which was prepared by PCR according to the manufacturer's instructions (Roche).
The constructs were obtained and transformed into rice callus using Agrobacterium tumefaciens (strain EHA105), as described previously (Ai et al.
9
Northern Blot Analysis of JEV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For JEV genome and sfRNAs detection, total RNAs extracted from BHK-21 cells infected with different mutant viruses were analysed by Northern blotting assay. About 20 μg of RNAs was loaded on a 1.5% agarose-2% formaldehyde gel followed by transfer onto Hybond-N+ membranes (GE healthcare) using capillary migration with 20×SSC buffer (3 M sodium chloride, 0.3 M sodium citrate, pH 7.0). Next, the blots were UV-crosslinked and hybridized with digoxigenin (DIG)-ddUTP-labelled 3′-UTR DNA probes. Membrane blocking, washing and visualization were performed using the DIG High Prime DNA Labelling and Detection Starter Kit I (Roche). The blocking buffer was prepared by diluting the Vial 6 of Kit I (1:10) into maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl, pH 7.5). The composition of the washing buffer was 0.1 M maleic acid, 0.15 M NaCl, pH 7.5 and 0.3% Tween 20 (v/v). The DNA probe used for Northern Blot detection contained the sequence from 10847 to 10977 nt of the viral genome, which was obtained by PCR using the primer pair, JEV-10847-F and JEV-10977-R (Table S1).
10
Southern Blot Analysis of E. festucae
Check if the same lab product or an alternative is used in the 5 most similar protocols
E. festucae genomic digests, separated by agarose gel electrophoresis, were transferred to positively charged nylon membranes (Roche) (Southern,1975 ) and fixed by UV light cross‐linking in a Cex‐800 UV light cross‐linker (Ultra‐Lum, Claremont, California, USA) at 254 nm for 2 min. Digoxigenin‐dUTP (DIG) labelling and hybridization of the plsA DNA probe and nitroblue tetrazolium chloride and 5‐bromo‐4‐chloro‐3‐indolyl‐phosphate (NBT/BCIP) visualization were performed as per the manufacturer’s instructions using the DIG High Prime DNA Labelling and Detection Starter Kit I (Roche).
+ Expand
E. festucae genomic digests, separated by agarose gel electrophoresis, were transferred to positively charged nylon membranes (Roche) (Southern,
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!