Abi prism 7500 fast real time pcr system

The colon grinded with liquid nitrogen and RNA was isolated with TRIzol (Life Technologies). The quality of the RNA was determined on a 1 % agarose gel for 2 h at 60 V. Reverse transcription (RT) was operated with the Super Script III First-Stand Synthesis System (Invitrogen). To detect the mRNA level of the target genes, quantitative real-time PCR (qRT-PCR) was performed using a SYBR Premix Ex TaqII (TaKaRa). The qRT-PCR procedure was according to the manufacturer’s instructions from TaKaRa and ran with ABI PRISM7500 Fast Real-Time PCR System. The primers of iNOS, Fizz-1, STAT1, SOCS-1 and β-actin (control) were listed in Table 1.Table 1

Rat primers for real-time PCR

Gene	Forward Primer	Reverse Primer
iNOS	GATTTTTCACGACACCCT	GGTCCTCTGGTCAAACTC
Fizz-1	CAACAGGATGAAGACTGCAACCT	GGGACCATCAGCTAAAGAAG
STAT1	AGGTCCGTCAGCAGCTTAAA	CGATCGGATAACAACTGCTT
SOCS-1	CCGTGGGTCGCGAGAAC	AAGGAACTCAGGTAGTCACGGAGTA
β-actin	TTCAACACCCCAGCCATGT	CAGTGGTACGACCAGAGGCATA

The total RNA was extracted from CRC cell lines with RNAiso Plus (Takara, Japan). To detect miR-106b, a stem-loop reverse transcription-polymerase chain reaction (RT-PCR) was performed using All-in-One TM miRNA quantitative RT-PCR (qRT-PCR). The sequence-specific forward primers for mature miR-106b and the U6 internal control were 5-TGTAAAGTGCTGACAGTGCA-3 and 5-CTCGCTTCGGCAGCACA-3, respectively. The relative expression was calculated via the comparative cycle threshold (Ct) method using the expression of U6 small nuclear RNA as the reference. The qRT-PCR for the analysis of mRNA expression was performed on a Stratagene ABI PRISM7500 Fast Real-time PCR system using the SYBR Green qRT-PCR master mix (TaKaRa) and GAPDH as an internal control. The primers are listed in Additional file 1: Table S1. All Data were processed using the 2^−△△CT method.

For qRT-PCR analysis, total RNA was extracted by using an RNA-simple Total RNA Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. P. sojae and N. benthamiana cDNA was synthesized with the HiScript II Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd., Nanjing, China). Real-time PCR was performed by using a SYBR Premix Ex Taq Kit (Takara Bio Inc., Shiga, Japan) on an ABI Prism 7500 Fast Real-Time PCR system following the manufacturer’s instructions. Expression levels were normalized to the expression of NbACTIN and PsActin, which are stably expressed reference genes in N. benthamiana and P. sojae, respectively. The primers used for qRT–PCR are listed in S4 Data. All the qRT-PCR results showed in this study were calculated from three independent biological replicates.
For bioinformatics analysis, sequences were aligned using the MUSCLE software [58 (link)]. Phylogenetic trees were constructed using the MEGAX software (https://www.megasoftware.net/) with Neighbor-Joining method (Bootstrap = 1000, p-distance, pairwise deletion) and visualized using EvolView v3 [59 (link)]. Weblogo were obtained using Weblogo 3 [60 (link)].