Primestar max

All Vector stocks were generated and maintained via transformation of chemically competent One Shot™ Stbl3™ E. coli cells from ThermoFisher (ThermoFisher, #C737303) and isolated from 5 mL cultures using QIAprep Spin Miniprep Kit (Qiagen, #27106) following the manufacturer’s protocol. Where appropriate, restriction digests were conducted using FastDigest restriction enzymes (Thermo Scientific) following manufacturer’s protocol. PCR was conducted in a thermocycler using PrimeSTAR Max (Takara, #R045A) following the manufacturer’s protocol. Restriction digests and PCR products were electrophoresed on 1% agarose gels in TAE buffer (40 mM Tris pH 7.6, 20 mM acetic acid, 1 mM EDTA) and visualised using SYBRSafe DNA stain (Invitrogen, #S33102). Desired bands were excised from the gel and extracted using QIAquick Gel Extraction Kit (Qiagen, #28704) following the manufacturer’s protocol. T4 ligations were performed using T4 DNA Ligase (ThermoFisher, #EL0014) and Gibson assembly via NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) following respective manufacturers protocols. All constructs were confirmed via Sanger sequencing. A list of primers used in this study is provided in Table S1.

Total RNA was isolated from mouse kidney, and first-strand cDNA was synthesized using the SuperScript IV First-strand Synthesis System (Thermo Fisher Scientific). The deduced open reading frames (ORFs) of mouse Otop1 (mOtop1) were amplified in two steps by nested-PCR using PrimeSTAR MAX (TaKaRa Bio). Exon-spanning primers were designed based on the mOtop1 nucleotide sequence in the NCBI database (accession no. NM_172709.3). The PCR products of the ORFs were subcloned into the pcDNA5/FRT mammalian expression vector using the In-Fusion HD Cloning kit (Takara Bio). The entire sequence of mOtop1 was confirmed using a BigDye Terminator system (Applied Biosystems).

The vectors were constructed with Gibson assembly (NEB) or ClonExpress II One Step Cloning (Vazyme, Nanjing) kits. PCRs were carried out with PrimeSTAR Max (Takara) or Q5 (NEB) following the manufacturers' instructions. Accessory plasmids (Esvelt et al, 2011 (link)) for T7 RNAP evolution contained, in order, an rrnB terminator, the promoter of interest, a strong RBS 5′‐AAGGAGGAAAAAAAATATATAATG‐3′ where underlined bases represent the start codon, gIII, either the combination of aadA gene conferring spectinomycin resistance and pUC origin for a high‐copy version or bla gene conferring carbenicillin resistance and SC101 origin for a low‐copy version. Reporter plasmids were identical to SC101 accessory plasmids except for the replacement of gIII by gfp. T7 RNAP selection phage (Esvelt et al, 2011 (link); Wu et al, 2021 (link)) was constructed by replacing all but the last 202 bp of gIII with the gene encoding T7 RNAP in M13K07 (NEB) helper phage and then removing the p15a origin of replication and aph gene to restore the M13 origin of replication. The mutagenesis plasmid (Esvelt et al, 2011 (link); Badran & Liu, 2015 (link)) contained dnaQ926, dam, and seqA under control of psp operon. Information about plasmids used in the study is listed in Appendix Table S4.

A construct for mammalian expression of Gal4-FusionRed-p65 fusion was created via the insertion of residues 2–148 of the yeast transcription activator Gal4 into the pEGFP-N1 backbone via NheI/BglII sites and subsequent substitution of EGFP-encoding sequence by AgeI/Not sites with the encoding residues 428–551 of human RELA protein (p65 domain). The resulting construct was amplified via polymerase chain reaction (PCR) using high-fidelity DNA polymerase PrimeSTAR Max (Takara Bio, Shiga, Japan), excluding the nucleotide segment corresponding to the region Val132–Asn173 of FusionRed FP, which comprised the 7 and 8 β-strands. The latter 126 bp DNA portion was amplified via error-prone PCR using a GeneMorph II random mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and inserted via blunt-end ligation in the amplified vector, containing the rest parts of the coding sequence. Ligated DNA mixture was purified using QIAprep 2.0 Spin Columns (Qiagen, Hilden, Germany) and used for electroporation of TOP10 E. coli cells (Invitrogen, Waltham, MA, USA). Bacteria were plated on LB agar with 100 µg/mL kanamycin. Constructs with the correct insert orientation were selected via PCR analysis.