Oligonucleotide probes complementary to mature miRNAs were end-labeled with γ-32P-ATP using T4 Polynucleotide Kinase (Takara, Dalian, China), and labeled probes were purified using a Sephadex G25 spin column (Roche, Indianapolis, IN, USA). Small RNA was extracted from 10 g of HS or 10 ml of HS decoction. RNA samples were fractionated by PAGE using a 15% denaturing polyacrylamide gel. The RNA was then transferred onto a nylon membrane (Hybond N+, Amersham Biosciences, Piscataway, NJ, USA) by electroblotting at 400 mA in 0.5× TBE buffer for 1.5 h. The membrane was cross-linked and dried. A prehybridization step was performed by incubating the membrane with 10 ml of ULTRAhyb-Oligo solution (Ambion, Austin, TX, USA) at 37 °C for 1 h. The radiolabeled probe was added directly to the ULTRAhyb-Oligo solution, and the membrane was incubated overnight at 37 °C with rotation in a hybridization oven. After hybridization, the membrane was washed twice at low stringency in 2× SSC, 0.1% SDS at 42 °C for 10 min. The membrane was wrapped in a plastic wrap and exposed to an X-ray film at −80 °C.
Ultrahyb oligo solution
Manufactured by Thermo Fisher Scientific
Sourced in United States
ULTRAhyb-Oligo solution is a pre-formulated hybridization buffer designed for use in northern blotting and microarray applications. It is optimized for the rapid and efficient hybridization of oligonucleotide probes to target nucleic acids.
Automatically generated - may contain errors
Lab products found in correlation
Hybond, by Cytiva (4 mentions)
Positively charged nylon membrane, by Cytiva (4 mentions)
T4 polynucleotide kinase, by Takara Bio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Hybond n, by Cytiva (1 mentions)
Sephadex g 25 spin column, by Roche (1 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (1 mentions)
Typhoon phosphorimager, by Cytiva (1 mentions)
Hybond n membrane, by Cytiva (1 mentions)
P32 γatp, by PerkinElmer (1 mentions)
Cyclone plus storage phosphor system, by PerkinElmer (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
α 32p dctp, by Cytiva (1 mentions)
T4 polynucleotide kinase, by New England Biolabs (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
γ 32p atp, by PerkinElmer (1 mentions)
Imagequant 5, by GE Healthcare (1 mentions)
Storm 860 gel and blot imaging system, by GE Healthcare (1 mentions)
Phosphor screen system, by GE Healthcare (1 mentions)
T4 pnk, by New England Biolabs (1 mentions)
10 protocols using ultrahyb oligo solution
1
Northern Blot Analysis of miRNA
2
Northern Hybridization for tRF/tRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern hybridization for tRF/tRNA was performed as we previously described [8 (link),30 (link),31 (link)]. To summarize the process: RNAs, pulled down by antisense DNA oligos, were separated in 15% denaturing polyacrylamide gel with 7 mol/L urea and then transferred to a positively charged nylon membrane (Amersham Biosciences, NJ, USA). The membrane was hybridized with a 32P-labeled DNA probe inversely complementary to the tRF of interest in ULTRAhyb-Oligo solution (Life Technologies, NY, USA), followed by washing according to the manufacturer’s instructions.
3
Northern Blot for tRF5-GluCTC Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern hybridization for tRF5-GluCTC was performed using a tRF5-GluCTC-specific probe as previously described [17 (link),20 (link)]. Briefly, RNA was separated in 15% denaturing polyacrylamide gel with 7M urea and then transferred to a positively charged nylon membrane (Amersham Biosciences, Piscataway, NJ, USA). The membrane was hybridized with 32P-labeled probes in ULTRAhyb-Oligo solution (Life Technologies, Grand Island, NY, USA) and washed three times according to the manufacturer’s instruction, followed by image development.
4
Northern Blot for tRF5-GluCTC Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern hybridization for tRF5-GluCTC was performed as described (Wang et al., 2013 (link)). Briefly, 3 µg RNA was loaded on 15% denaturing polyacrylamide gel with 7 M ureas and then transferred to a positively charged nylon membrane (Amersham Biosciences, NJ, United States). The membrane was hybridized with a 32P-labeled DNA probe in ULTRAhyb-Oligo solution (Life Technologies, Grand Island, NY, United States), followed by membrane washing and image development. The 32P-labeled DNA probe for tRF5-GluCTC was 5′-CGCCGAATCCTAACCACTAGACCACCA-3′.
5
Northern Blotting of tRFs
6
Northern Blot Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using Trizol reagent (Invitrogen, Carlsbad, CA), according to manufacturer’s directions. Total RNA (10–20 μg) was separated in a 15% poyacrylamide/7 M urea/0.5X TBE gel and transferred to Hybond-N+ membrane (Amersham, Piscataway, NJ). Hybridizations were carried out at 42°C with the Ultra-Hyb Oligo solution (Ambion, Austin, TX) using as probes DNA oligonucleotides labeled with P32-γATP (PerkinElmer) at their 5′ end using T4 polynucleotide kinase (Fermentas). Oligonucleotides used: miR-310-5’AAAGGCCGGGAAGTGTGCAATA3’ , miR-311-5’tcaggccggtgaatgtgcaata3’ , miR-312-5’tcaggccgtctcaagtgcaata3’ , miR-313-5’tcgggctgtgaaaagtgcaata3’ and as a loading control 2SRNA-5´TACAACCCTCAACCATATGTAGTCCAAGCA . Two washes using 2x SSC/0.1% SDS were carried for 30 min at 42°C. Autoradiographs were analyzed using a Typhoon PhosphorImager (Amersham). All membranes were exposed for 24 hours and control hybridizations were exposed for 5 minutes.
7
Analysis of Small RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from Arabidopsis rosette leaves with Trizol reagent (Sigma), according to the manufacturer's instructions. RNA gel blot analysis of high and low molecular weight RNA was performed with 10 and 30 μg of total RNA, respectively, and was as described previously (28 (link)). Ethidium bromide staining of total RNA, before transfer and U6 were used to confirm equal loading. RNA hybridizations were performed using the ULTRAHyb Oligo solution, according to the manufacturer's instructions (Ambion). Radiolabeled probes for detection of the LUC, SUL or PDS siRNAs were made by random priming reactions in the presence of [α-32P]-dCTP (Amersham). The template used was a 400 bp PCR product amplified from LUC cDNA. The 400 bp (for SUL) and 500 bp (for PDS) PCR products were amplified from Arabidopsis cDNA. DNA oligonucleotides complementary to miRNAs, tasiRNAs or hc-acting siRNAs were end-labeled with [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs). All hybridization signals were detected by phosphor-imaging (Cyclone Plus Storage Phosphor System; PerkinElmer).
8
Northern Blot Analysis of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Invitrogen). RNA (20 ug) was separated by 15% PAGE/8 M urea/ 1x TBE buffer. Gels were electro-blotted to a Hybond-N+ membrane (GE Healthcare) and UV cross-linked twice. Oligonucleotide probes (Supplementary Table 10 ) were labeled using [γ-32P]-ATP (Perkin-Elmer) and T4 PNK (New England Biolabs). Labeled probes were purified with the Quick spin-oligo columns (Roche) before hybridization. Hybridizations were performed at 42°C overnight in UltraHyb-oligo solution (Ambion). After hybridization, membranes were washed twice in 2 × SSC/0.1% SDS and exposed to the Phosphor Screen System (GE Healthcare). The screen was scanned in a Storm 860 Gel and Blot Imaging System (GE Healthcare). As loading control, an oligonucleotide probe complementary to the U6 small nuclear RNA was used. Signal intensities were quantified using the ImageQuant 5.2 software (Molecular Dynamics). The U6 signal intensity in each blot was used for normalization and calculation of expression ratios. The same loading control was employed for membranes used more than once.
9
Northern Blot Analysis of SRP RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen) and resolved alongside a single-stranded RNA ladder (New England Biolabs) in a 6% polyacrylamide gel containing 7 M urea. The RNA was transferred to a Hybond-XL nylon membrane (Amersham) and crosslinked by UV irradiation (120 mJ; UV Stratalinker 2400, Stratagene). Crosslinked membranes were blocked with ULTRAhyb-Oligo solution (Ambion) for 30 min at 42°C, then incubated overnight at 47°C with DNA probes complementary to the SRP RNA (Supplementary Table S3), which had been 5′ end radiolabeled according to manufacturer's instructions (KinaseMax, Ambion). Hybridized membranes were washed four times, 30 min each (2x SSC, 0.5% SDS), then imaged using a storage phosphor screen (Amersham).
10
Photoperiodic Flowering and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plants were grown in soil at 22 C under LDs until flowering. Flowering times were determined by counting the number of rosette leaves at bolting. Twenty to thirty plants were counted and averaged for each measurement. Presence of abaxial trichomes was used to differentiate between the juvenile and adult vegetative leaves. Reciprocal transfer experiments were performed to examine the effects of plant age on photoperiodic induction of flowering. Plants were grown under SDs for up to 4 weeks and transferred to LDs for 3 days. The plants were then returned to SDs and grown until flowering. The numbers of rosette and cauline leaves of $20 plants were counted and averaged.
miRNA Northern Blot Analysis Total RNA samples were extracted from appropriate plant materials by the TriZOL method according to the procedure provided by the manufacturer (Invitrogen, Carlsbad, CA). miRNA Northern blot analysis was performed using the ULTRA-Hyb Oligo solution according to the procedure provided by the manufacturer (Ambion, Houston, TX). Oligonucleotide probes were 5 0 end labeled with [g-32 P]ATP and T4 polynucleotide kinase (Takara). An oligonucleotide complementary to 5S rRNA was processed in the same manner and used as quality control for RNA preparation.
miRNA Northern Blot Analysis Total RNA samples were extracted from appropriate plant materials by the TriZOL method according to the procedure provided by the manufacturer (Invitrogen, Carlsbad, CA). miRNA Northern blot analysis was performed using the ULTRA-Hyb Oligo solution according to the procedure provided by the manufacturer (Ambion, Houston, TX). Oligonucleotide probes were 5 0 end labeled with [g-32 P]ATP and T4 polynucleotide kinase (Takara). An oligonucleotide complementary to 5S rRNA was processed in the same manner and used as quality control for RNA preparation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!