The BVDV envelope RNase glycoprotein, Erns, was detected in heparinised blood samples post-challenge using the HerdChek® BVDV Antigen/Serum Plus ELISA kit according to the manufacturer’s instructions (IDEXX Switzerland AG, Liebefeld-Bern, Switzerland). BVDV RNA was extracted from EDTA blood samples post-challenge using the QIAamp Viral RNA Mini Kit (Qiagen, Crawley, UK) as described by the manufacturer. BVDV RNA content measured using a single tube nested quantitative RT-PCR (qRT-PCR) TaqMan® assay as described69 (link). Signal was detected using a Stratagene MX3000 P Real-Time PCR machine (Agilent Technologies, La Jolla, CA, USA) and data analysed on the MX Pro 4.1.0c Software (Agilent Technologies). Relative quantities of viral RNA in samples were quantified by interpolation against a 10-fold dilution of RNA extracted from an equivalent volume of virus (BVDV-1a Oregon C24V) of known titre (standard range from 107.55 to 100.55 TCID50/ml)70 (link).
Stratagene mx3000p real time pcr machine
Manufactured by Agilent Technologies
Sourced in United States
The Stratagene MX3000P Real-Time PCR machine is a laboratory instrument that performs real-time polymerase chain reaction (PCR) analysis. It is designed to amplify and quantify specific DNA sequences in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
One step primescript rt pcr kit, by Takara Bio (1 mentions)
Ultrapure glycogen, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Primescript rt master mix perfect real time, by Takara Bio (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
5 protocols using stratagene mx3000p real time pcr machine
1
Quantifying BVDV RNA Post-Challenge
2
Quantitative TSWV detection in plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus-inoculated plants were maintained and monitored for symptom expression up to 35 dpi. TSWV-inoculated leaf tissues were collected at 4, 7, 14, 21 and 35 dpi, respectively. For sample collection, a small piece of leaf tissue (500 mg) from inoculated leaf (Sw-7 and S-line) was collected at 4 dpi and subsequent collections were performed on systemic young leaf at other time points (7, 14, 21 and 35 dpi). Inoculated plants were tested to confirm for the presence and concentration of TSWV using real-time RT-qPCR52 (link). RT-qPCR was performed using the TaqMan probe 5′HEX-AAATCTAAGATTGCTTCCCACCCTTTGATTCAA-BHQ, with forward primer 5′GCTTGTTGAGGAAACTGGGAATT and reverse primer 5′AGCCTCACAGACTTTGCATCATC52 (link) located in the N gene of TSWV and Takara One Step PrimeScript RT-PCR Kit (Clontech, USA) following manufacturer’s instructions. The One-step RT-qPCR reaction was carried out on a Stratagene MX3000P Real-Time PCR machine (Agilent, USA), under the following conditions: 50 °C for 30 min, denaturation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 1 min and 55 °C for 30 sec.
3
Quantitative RNA Expression Analysis of NSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from approximately 1 × 106 fetal‐derived NSCs, a minimum of 1 × 103 FACS‐isolated cells, and the microdissected DG of 2–3 animals per condition was performed with Trizol (Life Technologies) according to the manufacturer's suggested modifications, by the addition of ultrapure glycogen (Life Technologies). First‐strand complementary DNA was synthesized from 200 ng of RNA using the Precision Nanoscript Reverse Transcriptase kit (PrimerDesign Ltd., U.K., http://www.primerdesign.co.uk ) according to manufacturer's recommendations. Real‐time quantitative polymerase chain reaction (RT‐qPCR) was performed on a Stratagene Mx3000p Real Time PCR machine (Agilent Technologies, CA, http://www.home.agilent.com ), with Precision 2× RT‐PCR MasterMix (PrimerDesign Ltd.) using primers against Chd7, hChd7 (which may recognize mouse Chd7), Hes5, rHes5 (which may recognize mouse Hes5), Pax6 (Designed by PrimerDesign Ltd.), Ccnb1, Ccnd1, Ccnd2, Ccne1, Cdk1, Cdk2, Btg1, Mtor, Nestin, and Gapdh as a normalizing control to give ΔΔCq values relative to wild‐type samples. Primer sequences are shown in Supporting Information Table 1.
4
Cardiac Gene Expression Analysis
5
Quantitative PCR Analysis of T Cell Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified CD4+ T cells were cultured in 24-well flat-bottom plates coated with 5 μg/ml of anti-CD3 (145-2C11, BD Pharmingen) and 2 μg/ml anti-CD28 (37.51, BD Pharmingen) in the absence or presence of ECF at indicated concentrations. Total RNA was isolated 16 h after stimulation with anti-CD3 and anti-CD28 using RNeasy Kit (Qiagen). 1 μg of total RNA was used to synthesize cDNA using PrimeScript RT Master Mix Perfect Real Time (TaKaRa). IFN-γ, T-bet, STAT1, and STAT4 mRNA levels were detected by real-time quantitative PCR using SYBR Premix Ex Taq II kit (TaKaRa). Samples were assayed on Stratagene MX3000P Real-Time PCR machine (Agilent), and the relative expression level of the respective samples to β-actin was calculated with the delta-delta Ct. The gene-specific primers used were as follows:
IFN-γ: (sense) 5′-ATGAACGCTACACACTGCATC-3′
(Antisense) 5′-CCATCCTTTTGCCAGTTCCTC-3′
T-bet: (sense) 5′-CCAGGAAGTTTCATTTGGGAAGC-3′
(Antisense) 5′-ACGTGTTTAGAAGCACTG-3′
STAT1: (sense) 5′-TCACAGTGGTTCGAGCTTCAG-3′
(Antisense) 5′-CGAGACATCATAGGCAGCGTG-3′
STAT4: (sense) 5′-GCAGCCAACATGCCTATCCA-3′
(Antisense) 5′-TGGCAGACACTTTGTGTTCCA-3′
β-Actin: (sense) 5′-GGCTGTATTCCCCTCCATCG-3′
(Antisense) 5′-CCAGTTGGTAACAATGCCATGT-3′.
IFN-γ: (sense) 5′-ATGAACGCTACACACTGCATC-3′
(Antisense) 5′-CCATCCTTTTGCCAGTTCCTC-3′
T-bet: (sense) 5′-CCAGGAAGTTTCATTTGGGAAGC-3′
(Antisense) 5′-ACGTGTTTAGAAGCACTG-3′
STAT1: (sense) 5′-TCACAGTGGTTCGAGCTTCAG-3′
(Antisense) 5′-CGAGACATCATAGGCAGCGTG-3′
STAT4: (sense) 5′-GCAGCCAACATGCCTATCCA-3′
(Antisense) 5′-TGGCAGACACTTTGTGTTCCA-3′
β-Actin: (sense) 5′-GGCTGTATTCCCCTCCATCG-3′
(Antisense) 5′-CCAGTTGGTAACAATGCCATGT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!