Total RNA was isolated from cells as previously described (27 (link)). RNA was first retrotranscribed using SensiFAST™ cDNA Synthesis kit (Bioline) and then quantitative PCR was carried out using SensiFAST SYBER® No-ROX kit. Primers for β-actin were used for loading control amplifications. Specific primer sets used for each gene are: GDA Forward (5′ to 3′) GCAACAATTCACACTGACTCATC; GDA Reverse (5′ to 3′) GTGTCACTATGGGCTTCACTC; β-actin Forward (5′ to 3′) CCAACCGCGAGAAGATGA; β-actin Reverse (5′ to 3′) CCAGAGGCGTACAGGGATAG. The comparative Ct method was used to calculate the relative abundance of the mRNA and compared with that of β-actin expression. Statistical analysis was performed as previously described (28 (link)).
Sensifast syber no rox kit
Manufactured by Meridian Bioscience
Sourced in United Kingdom
The SensiFAST SYBER® No-ROX kit is a real-time PCR reagent designed for use in quantitative gene expression analysis. It is a ready-to-use mixture of SYBR® Green I, hot-start DNA polymerase, dNTPs, and stabilizers, optimized for sensitive and reliable qPCR results.
Automatically generated - may contain errors
Lab products found in correlation
Sensifast cdna synthesis kit, by Meridian Bioscience (3 mentions)
Rna 6000 nano chip, by Agilent Technologies (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Bioanalyzer, by Agilent Technologies (1 mentions)
Nd 8000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Power syrb green pcr master mix, by Thermo Fisher Scientific (1 mentions)
5 protocols using sensifast syber no rox kit
1
Quantitative PCR Analysis of Gene Expression
2
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCT 116p53−/− and uL3ΔHCT 116p53−/− cells treated or not with Act D and transfected or not with pHA-uL3 using the miRNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and quantified using the ND-8000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). RNA integrity was assessed using an RNA 6000 Nano chip on a Bioanalyzer (Agilent Technologies, La Jolla, CA, USA).
Total RNA was retrotranscribed as previously reported [40 (link)] and qPCR was carried out using SensiFAST SYBER® No-ROX kit (Bioline, London, UK). The primers are indicated inTable 1 . The comparative Ct method was used to calculate the relative abundance of the mRNA and compared with that of β-actin expression [41 (link)].
Total RNA was retrotranscribed as previously reported [40 (link)] and qPCR was carried out using SensiFAST SYBER® No-ROX kit (Bioline, London, UK). The primers are indicated in
3
Real-Time RT-PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells, as previously described [32 (link)]. RNA was retrotranscribed using a SensiFASTTM cDNA Synthesis kit (Bioline, London, UK), and then real-time PCR was carried out using a SensiFAST SYBER® No-ROX kit (Bioline, London, UK). The primers are indicated in Table 2 . The comparative Ct method was used to calculate the relative abundance of the mRNA and compared with that of β-actin expression [33 (link)].
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells as previously described46 (link). RNA was first retrotranscribed using SensiFASTTM cDNA Synthesis kit (Bioline) and then realtime PCR was carried out using SensiFAST SYBER® No-ROX kit. The primers are indicated in Table 1 . The comparative Ct method was used to calculate the relative abundance of the mRNA and compared with that of β-actin expression47 (link).
5
Real-Time PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed with a QuantiTect SYBR Green PCR Kit (Qiagen, Milan, Italy), SensiFAST SYBER No-ROX Kit (Bioline, Milan, Italy), a Rotor-Gene TM Q thermocycler (Qiagen, Milan, Italy) and PowerSYRB Green PCR Master Mix (Applied biosystems, Warrington, UK), and a 7900HT Fast Real-Time PCR System (Applied biosystems, Warrington, UK) using listed in Table 1 human primers:
The expression data of GAPDH and 18S were used as internal control for data normalization.
The expression data of GAPDH and 18S were used as internal control for data normalization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!