The largest database of trusted experimental protocols

Sybr green pcr master one mix kit

Manufactured by Transgene
Sourced in China

The SYBR-Green PCR Master One-Mix kit is a laboratory reagent designed for real-time polymerase chain reaction (PCR) analysis. The kit contains a pre-optimized master mix, including SYBR Green I dye, DNA polymerase, and other necessary components for efficient and reliable real-time PCR amplification.

Automatically generated - may contain errors

2 protocols using sybr green pcr master one mix kit

1

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol® (Thermo Fisher Scientific). PrimeScript RT kit was used to reverse the mRNA into cDNA, and the SYBR-Green PCR Master One-Mix kit (TransGen, Biotech, Co., Ltd.) was used for quantitative real-time PCR. β-actin was used as an internal control. The sense and anti-sense primers were listed in Table 1.

The primers used in this study

GeneSequences (5′-3′)
SenseAnti-sense
RBM14CTTCGACTACCAGCAGGCTTTTCCGTCAGAGGCGCCACATAAG
EP300ATTAAGGAACTGGAACAGGAGAGAGGTCGTTAGATACATTGG
HK2TGATGTGGCTGTGGATGAGCTGCCAGGCAGTCACTCTCAATCTG
PDK1GTGTAGATTAGAGGGATGAAGGAATAGTGGGTTAGG
PKM2GCACACCGTATTCAGCTCTGTCCAGGAATGTGTCAGCCAT
LDHAAGGCTGGGAGTTCACCCATTAAGCGAGTCCAATAGCCCAGGATGTG
GLUT1TGTCGTGTCGCTGTTTGTGGTGGATGAAGAACAGAACCAGGAGCACAG
GLUT3GAGGTGCTGCTCACGTCTCTTGAATTGCGCCTGCCAAAG
β-actinATTGGCAATGAGCGGTTCCGTGGATGCCACAGGACT
+ Open protocol
+ Expand
2

qRT-PCR Analysis of HOTAIR, miR-206, and CCL2

Check if the same lab product or an alternative is used in the 5 most similar protocols
After 48 hours of transfection and culture, the total RNA was extracted by Trizol reagent (Invitrogen, Carlsbad,USA) for qRT-PCR detection. The SYBR Green PCR Master One-Mix kit (Transgen, Beijing, China) and cDNA Reverse Transcriptase Kit (TAKARA, Beijing, China) were purchased from ElifeBio (Hangzhou, China). Real-time PCR 7300 System (Applied Biosystems, Foster City, USA) was used for qRT-PCR detection. The reaction conditions were as follows: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, and 35 cycles. Each group was repeated 3 times. Relative quantification of RNA expression was calculated using the 2-ΔΔCT method. All the primers of HOTAIR, miR-206, CCL2 and GAPDH were shown in Table S.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!