Perfectstart sybr qpcr mix

Manufactured by Vazyme

PerfectStart® Sybr qPCR Mix is a real-time PCR reagent developed by Vazyme. It is designed for quantitative gene expression analysis using SYBR Green I dye technology.

Automatically generated - may contain errors

Lab products found in correlation

Isolation trizol buffer, by MultiSciences Biotech (3 mentions) Rt pcr kit, by Yeasen (3 mentions)

3 protocols using perfectstart sybr qpcr mix

Quantification of miR-494-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular or exosomal total RNA was extracted utilizing ISOLATION TRIzol buffer® (Multi Sciences, Hangzhou), followed by cDNA synthesis from the reverse-transcribed RNA using the RT-PCR Kit (Yeasen, China) following the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed using the PerfectStart® Sybr qPCR Mix (Vazyme, Nanjing). Expression levels were determined using the 2^−ΔΔCt method. The primers for miR-494-3p and U6 were as follows.

Gene	Forward seq	Reverse seq
U6	5′-AGGCTTGCTGCTCGGCAGTTGAT-3′	5′-AAGCTAGCTGATCGATCGCTCT-3′
mi-494-3p	5′-TGAAACATACACGGGAACCA-3′	5′-ATGCTGCTAGCTGATCGCTAGCT-3′

Zhang L., Xue Y, & Zhang H. (2024). Suppression of gastric cancer cell proliferation by miR-494-3p inhibitor-loaded engineered exosomes. Heliyon, 10(10), e30803.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of ErbB4 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following the supplier's protocol, total RNA was recovered from cells by using ISOLATION TRIzol buf-fer® (Multi Sciences, Hangzhou), and cDNA was obtained from reverse-transcribed RNA with the RT-PCR Kit (Yeasen, China). The qRT-PCR was used PerfectS-tart® Sybr qPCR Mix (Vazyme, Nanjing). The expression levels were calculated by 2 -ΔΔCt assay. Primers of ErbB4 and β-actin were stated below: β-actin (human): 5'-CCATCGCCAGTTGCCGATCC-3' (F) and 5'-GC-GAGAGGAGCACAGATACCACCAA-3' (R); ErbB4 (human): 5'-GTCCAGCCCAGCGATTCTC-3' (F) and 5'-AGAGCCACTAACACGTAGCCT-3' (R); ErbB4 (mouse): 5'-CCTTCCTGCGGTCTATCCGA-3' (F) and 5'-CCAAAGTTGCCATCTTTCCTGTA-3' (R); β-actin (mouse): 5'-GTGACGTTGACATCCGTAAAGA-3' (F) and 5'-GCCGGACTCATCGTACTCC-3' (R).

Tang R., Cui H., Dou R., Tao L., Tan L., Guo T, & Luo D. (2023). ErbB4 affects Th1/Th17 cell differentiation and promotes psoriasis progression. Cellular and molecular biology (Noisy-le-Grand, France), 69(12).

+ Open protocol

+ Expand

Quantifying Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following the supplier's protocol, total RNA was recovered from cells using ISOLATION TRIzol buffer® (Multi Sciences), and cDNA was obtained from reverse‐transcribed RNA using an RT‐PCR kit (Yeasen). qPCR was performed using the PerfectStart® Sybr qPCR Mix (Vazyme). The expression levels of genes were calculated using the 2‐∆∆Ct method.²⁶ The primer sequences for TNIP2 and‐actin were as follows: β‐actin:5′‐CCATCGCCAGTTGCCGATCC‐3′ (F) and 5′‐GCGAGAGGAGCACAGATACCACCAA‐3′ (R); TNIP2:5′‐AAGTCCTGACCAGTCGGAACA‐3′ (F) and 5′‐CCAGCAGGGACGAATACGTG‐3′ (R).

Qian X., Wang Y., Li X., Li Y, & Li L. (2023). TNFAIP3 interacting protein 2 relieves lipopolysaccharide (LPS)‐induced inflammatory injury in endometritis by inhibiting NF‐kappaB activation. Immunity, Inflammation and Disease, 11(10), e970.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!