Transstart fastpfu dna polymerase

Cas9 and sgRNA plasmids were constructed per the previously published method (Han et al., 2014 (link)). Cas9 and sgRNA coding regions containing a T7 promoter were amplified by PCR using TransStart FastPfu DNA Polymerase (TransGen Biotech, Beijing, China) from each plasmid. The T7-Cas9 and T7-sgRNA polymerase chain reaction (PCR) products were purified and used as the template for in vitro transcription (IVT) using the mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Life Technologies, Inc., Grand Island, NY, USA). The poly (A) tailing reaction was performed after the capping was complete using a Poly (A) Tailing Kit (Life Technologies, Inc., Grand Island, NY, USA) per the manufacturer’s instructions. After the IVT, the sgRNA and Cas9-encoding mRNA were purified by ethanol and lithium chloride separately, then precipitated and dissolved in RNase-free water, and finally stored at −80 °C until use.

The V3-V4 hypervariable regions of the 16S rDNA were amplified with primers 341F (5′-CCTACGGGNGGCWGCAG-3′) and 805R (5′-GACTACHVGGGTATCTAATCC-3′) using an EasyCycler 96 (PCR) system (Analytik Jena Corp., AG, Germany). PCR was conducted using the following program: 3 min of denaturation at 95°C, 21 cycles of 0.5 min at 94°C (denaturation), 0.5 min for annealing at 58°C, 0.5 min at 72°C, and 5 min at 72°C for a final extension. PCR was performed in a 20-μl reaction system containing 4 μl 5 × Fastpfu buffer, 2 μl 2.5 mM deoxynucleotide triphosphates (dNTPs), 0.8 μl of each primer (5 μM), 0.4 μl TransStart Fastpfu DNA polymerase (TransGen Biotech, Beijing, China), and 10 ng template DNA. The PCR products were detected on a 2% agarose gel, and the band was extracted and purified using the AxyPrepDNA gel (Axygen, CA, USA) and PCR clean-up system. The purified PCR products were mixed. Sequencing was performed on an Illumina MiSeq platform according to the standard protocols of the Shanghai Mobio Biomedical Technology Co. Ltd., China. The raw read data of all the samples have been deposited in the European Bioinformatics Institute European Nucleotide Archive database under the accession number: PRJNA574226.

Microbiome DNA from FIS contents were extracted using the Cetyl trimethyl ammonium bromide (CTAB)/SDS method according to a previously described protocol [27 (link)], and the purity and concentration of DNA were detected by agarose gel electrophoresis. Using diluted genomic DNA (1 ng/μL) as template, specific primers with the barcode (Forward (5′-3′): AGAGTTTGATCCTGGCTCAG, Rreverse (3′-5′): GNTACCTTGTTACGACTT) were amplified from full-length 16S rRNA genes. TransStart^® FastPfu DNA Polymerase (TransGen Biotech Co., LTD, Bejing, China) was used in all PCR reactions in our study. The PCR products were detected by electrophoresis using 2% agarose gel, and then the products were purified with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). According to the manufacturer’s instructions, the DNA library was prepared using SMRTbellTM Template Prep Kit (Pacific BioSciences, Inc., Menlo Park, CA, USA) and then sequenced on the PacBio platform (Pacific BioSciences, Inc., Menlo Park, CA, USA).

Restriction enzymes and DNA ligase were purchased from Fermentas (Thermo Fisher Scientific Inc. Waltham, USA). TransStart FastPfu DNA polymerase was obtained from TransGen Biotech (Beijing, CN). ClonExpress^TM MultiS One Step Cloning kit was obtained from Vazyme Biotech (Nanjing, CN). Plasmid extraction kits and DNA gel extraction kits were purchased from Qiagen (Valencia, CA). LipoFiter^TM transfection reagent was purchased from Hanbio Biotech (Shanghai, CN). TRIzol reagent was obtained from Invitrogen (Carlsbad, CA, USA). EGF was purchased from peprotech (Rocky Hill, NJ, USA). Gefitinib was from AstraZeneca (London, UK). D-Luciferin potassium was from Xenogen (Alameda, CA). Coelenterazine was purchased from Regis (Morton Grove, IL, USA).

The plasmids and primers are listed in Table S1 and Table S2, respectively. PCR amplifications were executed in the T100TM Thermal cycler (Bio-Rad, Hercules, CA, USA). TransStart-FastPfu DNA polymerase as a High-Fidelity DNA polymerase (TransGene Biotech, Beijing, China) was used to amplify the gene fragments. PCR screenings for transformants were performed by using 2×Taq Mix kit (Tiangen Biotech, Beijing, China). PCR reaction and thermal profiles were referred to the manufacturer´s instructions. The restriction enzymes used in this work were obtained in New England Biolabs (New England Biolabs Inc. (NEB), Ipswich, MA, USA). To generate the deletion cassette, we used Fusion PCR strategy as described previously [51 (link)]. Briefly, G418 was amplified from the pAG1-H3-G418, and around 1.1 kb of fragments upstream and downstream of the gene PfptaA were amplified from P. fici genomic DNA using the designed primers. The three PCR fragments were ligated into the T-vector p-Blunt, and then were amplified for transformation in P. fici strains.

The nCas9, APOBEC1, UGI, ecTadA, and ecTadA7.10 portions of PBEcs and PABEcs were amplified from PBE or PABE-7 [19 (link), 25 (link)]. The Cas9 variant nCas9-NG (D10A) containing the R1335V/L1111R/D1135V/G1218R/E1219F/A1322R/T1337R substitutions was amplified from STEME-NG [41 ]. Binding proteins, including MCP, PCP, N22p, and Com, were synthesized commercially (GenScript, Nanjing, China). The different components of PBEcs, PABEcs, and SWISSv2/v3 were assembled into the pJIT163 backbone by One Step Cloning (ClonExpress II One Step Cloning Kit, Vazyme, Nanjing, China). The sgRNA constructs pOsU3-sgRNA and pOsU3-esgRNA have been previously described [25 (link)]; the TaU6 promoter was amplified from pTaU6-sgRNA [25 (link)]. All the scRNAs listed in Additional file 2: Sequences S2 were synthesized commercially and used to replace the sgRNA in pOsU3-esgRNA by One Step Cloning. Annealed oligos were inserted into BsaI (New England BioLabs)-digested OsU3-derived vectors. To construct the pH-SWISSv2/v3 binary vector, this cassette was cloned into the pHUE411 backbone under the Ubi-1 promoter of maize [47 (link)]. PCR was performed using TransStart FastPfu DNA Polymerase (TransGen Biotech, Beijing, China). All primer sets used in this work were listed in Additional file 1: Table S5 and were synthesized by Beijing Genomics Institute (BGI).

The wild-type strain N2 Bristol and all the mutants were cultured on the nematode growth medium (NGM) plates seeded with Escherichia coli OP50 at 20 °C following the standard protocol (Brenner, 1974). Standard cloning procedure of Clontech In-Fusion PCR Cloning System was used to construct all the plasmids. PCR products were produced by Phusion DNA polymerase (New England Biolabs) or TransStart FastPfu DNA Polymerase (Transgen Biotech) or High-Fidelity Master Mix (TsingKe Biotech) following standard procedures. All the strains and plasmids used are listed in Supplementary Table 1, Supplementary Table 2, Supplementary Table 3, and Supplementary Table 4.