Ab32059

Manufactured by Abcam

Sourced in United States, United Kingdom

Ab32059 is a lab equipment product manufactured by Abcam. It is a versatile tool designed for use in various scientific applications. The core function of this product is to provide a reliable and consistent platform for conducting experiments and analyses.

Automatically generated - may contain errors

Lab products found in correlation

11 protocols using ab32059

Western Blot Analysis of Apoptosis Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

H1299 and A549 were rinsed with PBS. These cells were subsequently
lysed with lysis buffer (Beyotime), enduring such conditions for 30
min at 4 °C. Following the lysis, samples were centrifuged at
high velocity, facilitating protein separation. The protein concentration
within these samples was detected via a BCA assay. Each protein sample,
consisting of 25 μg, was denatured, followed by undergoing SDS–PAGE.
They were then shifted onto polyvinylidene fluoride membranes (Millipore)
and blocked, then subjected to incubation with cIAP2 antibodies at
4 °C for 12 h, which was incubated with HRP-conjugated antibodies.
The proteins were henceforth visualized using a chemiluminescence
detection kit (Beyotime). Antibodies: anti-cIAP2 (ab32059; 1:10,000;
Abcam), anti-HSP90B1 (ab23812; 1:1,000; Abcam), anti-ERK1/2 (ab184699;
1:5,000; Abcam), and anti- PERK (ab229912; 1:1,000; Abcam).

Suo F., Wu Y., Zhou Q., Li L, & Wei X. (2024). BIRC3–HSP90B1 Interaction Inhibits Non-Small Cell Lung Cancer Progression through the Extracellular Signal-Regulated Kinase Pathway. ACS Omega, 9(17), 19148-19157.

+ Open protocol

+ Expand

Immunohistochemical Analysis of BIRC3 in Lung Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal lung tissue and tumor tissue were obtained from Shanghai Outdo
Biotech Co, Ltd. (Shanghai, China). IHC was conducted using the All-in-One
Kit for Immunohistochemical Staining of Tissues (Invitrogen, USA).
Staining for Anti-BIRC3 (Abcam, ab32059) was carried out at a dilution
of 1/600.

+ Open protocol

+ Expand

Western Blot Analysis of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used standard techniques to perform western blotting, using GAPDH as a control for whole-cell lysates. Antibodies were the following: RDH10 (ab174340, Abcam, Cambridge, UK), CDKN1A (ab7960, Abcam), BIRC3 (ab32059, Abcam), BMPR2 (ab130206, Abcam), NFKBIA (ab7217, Abcam), TGFBR1 (ab31013, Abcam), GADD45A (ab180768, Abcam) and GAPDH (sc-32233, Santa Cruz Biotechnology, Dallas, TX, USA).

Guan F., Wang L., Hao S., Wu Z., Bai J., Kang Z., Zhou Q., Chang H., Yin H., Li D., Tian K., Ma J., Zhang G, & Zhang J. (2017). Retinol dehydrogenase-10 promotes development and progression of human glioma via the TWEAK-NF-κB axis. Oncotarget, 8(62), 105262-105275.

+ Open protocol

+ Expand

Western Blot Analysis of Apoptosis Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole cells were lysed using the RIPA lysis buffer with protease inhibitors (Roche) and centrifuged at 10000 × g for 10 min. The supernatants were assayed for protein concentration with a BCA protein assay kit (Thermo Scientific). Protein samples were heated at 97 °C for 5 min before loading and 50 μg of the samples were subjected to 4%-12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to poly-vinylidene fluoride (PVDF) membranes for 50 min at 20 V. The membranes were blocked with a blocking buffer (Invitrogen) for 30 min at room temperature and incubated overnight at 4 °C with primary antibodies. The following primary antibodies were used: 1:1000 mouse monoclonal anti-HuR from Abcam (ab186430), 1:5000 rabbit monoclonal anti-IAP1 from Abcam (ab108361), 1:1000 rabbit monoclonal anti-IAP2 from Abcam (ab32059), and 1:10000 mouse monoclonal anti-GAPDH from Ambion (AM4300). The membranes were washed and incubated with the appropriate peroxidase-conjugated secondary antibody (Invitrogen; anti-mouse or anti-rabbit) for 30 min, washed and incubated with a chemiluminescence substrate/detection kit (Invitrogen). Results were analyzed with an automated documenting system (Biorad).

Lukosiute-Urboniene A., Jasukaitiene A., Silkuniene G., Barauskas V., Gulbinas A, & Dambrauskas Z. (2019). Human antigen R mediated post-transcriptional regulation of inhibitors of apoptosis proteins in pancreatic cancer. World Journal of Gastroenterology, 25(2), 205-219.

+ Open protocol

+ Expand

Apoptosis Regulator Protein Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected at each time point, and cell lysates were prepared as described. Western blots were performed with the following antibodies: antibody to caspase‐3 (1:2500, ab32351, Abcam, US), cIAP1 (1:1000, ab154525, Abcam, US), cIAP2 (1:1000, ab32059, Abcam, US), β‐actin (1:5000, CW0096M, CWBIO, China), Goat Anti‐Mouse IgG, HRP Conjugated (1:5000, CW0102S, CWBIO, China), Goat Anti‐Rabbit IgG, HRP Conjugated (1:5000, CW0103S, CWBIO, China).
Cell RNA was extracted by Trizol^® (ambion, life, America) as described. mRNA expression levels were detected using the EvaGreen kit (abm, America) with 40 cycles. The program was set according to the manufacturer's standard protocol. Results were analysed with the 2^−ΔΔCt method. The GAPDH was used as the house‐keeping gene in all PCR experiments. Primers: cIAP1 (Forward) 5′‐TTGTCAACTTCAGATACCACTGGAG‐3′; (Reverse) 5′‐CAAGGCAGATTTAACCACAGGTG‐3′; cIAP2 (Forward) 5′‐TCCTGGATAGTCTACTAACTGCC‐3′; (Reverse)5′‐GCTTCTTGCAGAGAGTTTCTGAA‐3′.

Sun H., Du Y., Yao M., Wang Q., Ji K., Du L., Xu C., He N., Wang J., Zhang M., Liu Y., Wang Y., Wen K, & Liu Q. (2021). cIAP1/2 are involved in the radiosensitizing effect of birinapant on NSCLC cell line in vitro. Journal of Cellular and Molecular Medicine, 25(13), 6125-6136.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein lysate was extracted on ice using radioimmunoprecipitation assay (RIPA) buffer, phenylmethanesulfonyl fluoride, phosphatase inhibitor, and protease inhibitor (KeyGEN, Nanjing, China). After separated in SDS-PAGE, proteins were transferred to polyvinylidene difluoride (PVDF) membrane. Then, the PVDF membrane was blocked with 5% buffer bovine serum albumin in TBST and exposed to primary antibody at 4 ℃ overnight. Next, the PVDF membrane was washed in TBST (10 min ×3 times) and exposed to secondary antibody (1:5,000; Abbkine, China) at room temperature for 1–1.5 hours (34 (link)). The band was incubated in BeyoECL Plus (Beyotime, China) and detected by chemiluminescence. The primary antibodies include anti-LOXL2 antibody (ab179810, Abcam), anti-BIRC3 antibody (ab32059, Abcam), anti-MDM2 antibody (ab259265, Abcam), anti-LC3B antibody (ab192890, Abcam), anti-ATG5 antibody (ab108327, Abcam).

Li N., Gu H., Liu L., Zhang X.L., Cheng Q.L, & Zhu Y. (2022). Inhibitory effects of LOXL2 knockdown on cellular functions of liver cancer stem cells. Translational Cancer Research, 11(7), 2013-2025.

+ Open protocol

+ Expand

Investigating Necroptosis Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Abcam provided rabbit anti-MLKL (ab184718), rabbit anti-phospho-RIP3 (T231, S232) (ab222320), rabbit anti-phospho-MLKL (S345)(ab196436), rabbit anti-TNFR1 (ab68160), rabbit anti-TRADD (ab110644), and rabbit anti-CIAP2 (ab32059) antibodies. Rabbit anti-RIP1 (3493 s) and rabbit anti-IκBα (9242) antibodies were purchased from Cell Signaling Technology. The mouse anti-GAPDH (AC033) antibody was purchased from AbClonal. Sigma provided the rabbit anti-RIP3 (PRS2283) antibody. Santa Cruz Biotechnology offered mouse anti-β-actin (sc-47778) antibody. Calbiochem (San Diego, CA, USA) offered Benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (ZVAD; 627610). Sigma-Aldrich offered propidium iodide (PI; P4170). Murine TNF-α (PMC3015) was purchased from Thermo Fisher. Ketamine (1707031) was obtained from Gutian Pharmaceutical Co. Ltd.

Deng B., Yang D., Wu H., Wang L., Wu R., Zhu H., Huang A., Song J., Cai T., Liu S., Wu J., Zhou H, & Li C. (2022). Ketamine inhibits TNF-α-induced cecal damage by enhancing RIP1 ubiquitination to attenuate lethal SIRS. Cell Death Discovery, 8, 72.

+ Open protocol

+ Expand

Protein Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein was extracted using RIPA buffer, and 30 µg of protein was separated by sodium dodecyl sulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) on a 10% gel. Then, proteins were transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked at room temperature for 1 hour. Then, all membranes were incubated with anti‐PKCα (1:1000, ab32376; Abcam, MA, USA), anti‐BIRC2 (1:1000, ab108361; Abcam), anti‐BIRC3 (1:1000, ab32059; Abcam), anti‐CDK4 (1:1000, ab108357; Abcam), anti‐TRAF1 (1:1000, ab197684; Abcam), anti‐BMP4 (1:1000, ab124715; Abcam), anti‐p‐IkB (1:1000, ab92700; Abcam), anti‐Bcl2 (1:1000, ab32124; Abcam) or anti‐GAPDH (1:5000; Santa Cruz, CA, USA) primary antibodies. After the membranes were incubated with secondary antibodies, they were washed three times with Tris‐buffered saline/Tween‐20 (TBST). A chemiluminescence system (Bio‐Rad, CA, USA) was used to detect the immunoreactive signals.

Zhang X., Zhang J., Zhang H., Liu Y., Yin L., Liu X., Li X., Yu X., Yao J., Zhang Z, & Kong C. (2021). Exploring the five different genes associated with PKCα in bladder cancer based on gene expression microarray. Journal of Cellular and Molecular Medicine, 25(3), 1759-1770.

+ Open protocol

+ Expand

Oridonin Induces Apoptosis in CAL-27 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protein lysates of CAL-27 cells in the control and drug groups (oridonin: 0, 5, 10, and 15 μM) were yielded with RIPA buffer on ice. Each set of protein samples was diluted to 5 μg/μL. PVDF membranes including identical amounts of total protein after electrophoresis were blocked using Quickblock^tm buffer (Beijing, China) and incubated with primary antibody against Bax (#2772, CST), cleaved caspase 3(#9661, CST), Bcl-w (#2724, CST), β-actin (#4970,CST), anti-cIAP2(ab32059, Abcam), and anti-TRAIL (ab231063, Abcam) at 4°C for 12 hours, accompanied by being incubated to secondary antibody (#98164, CST). Then, protein bands were visually analyzed using ECL Kits (Fude, China), and images were captured using a Tanon4600 camera system (Tanon, China).

Wu G., Guo Y., Liu Y., Cai X., Deng T., Pei T., Huang L., Chen K, & Pan X. (2023). Network-Based Method to Investigate the Promoted Cell Apoptosis Mechanisms of Oridonin in OSCC through the RNA-Transcriptome. Journal of Immunology Research, 2023, 5293677.

+ Open protocol

+ Expand

Western Blot Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular and tissue extracts were obtained as described53 (link). Lysates were resolved by SDS-PAGE under reducing conditions and electrotransfered onto Immobilon polyvinylidene difluoride membranes. Membranes were probed using antibodies against NOR-1 (H00008013-M06, Abnova), cIAP2 (ab32059, Abcam), HIF-1α (NB-100-449, Novus Biologicals) and β-actin (A5441, Sigma-Aldrich), followed by appropriate horseradish peroxidase-conjugated secondary antibodies and a chemiluminescent detection system. Equal loading was verified by Ponceau staining and by β-actin levels.

Alonso J., Galán M., Martí-Pàmies I., Romero J.M., Camacho M., Rodríguez C, & Martínez-González J. (2016). NOR-1/NR4A3 regulates the cellular inhibitor of apoptosis 2 (cIAP2) in vascular cells: role in the survival response to hypoxic stress. Scientific Reports, 6, 34056.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!