For all tissue-culture samples and 2-week hippocampus samples that were analyzed by random priming, the RNeasy Plus Kit (QIAGEN) and SuperScript VILO (Invitrogen) were used, according to the manufacturers’ instructions. For RNA-seq qRT-PCR validation, 500 ng of RNA from 2-, 4-, and 8-week hippocampus samples was reverse transcribed with the Bio-Rad iScript Synthesis Kit, as recommended by the manufacturer. qPCR was performed with the CFX96 Optical Reaction Module (Bio-Rad) using SYBR Green (Bio-Rad). Relative gene expression was determined using the ΔΔCt method71 (link) and normalized to Hprt for in vitro experiments and Gapdh for in vivo experiments. qPCR primer sequences are listed in Table S1 .
Cfx96 optical reaction module
Manufactured by Bio-Rad
Sourced in United States
The CFX96 optical reaction module is a laboratory instrument designed for real-time PCR analysis. It provides precise temperature control and fluorescence detection capabilities to support various genetic analysis applications.
Automatically generated - may contain errors
Lab products found in correlation
C1000 touch thermal cycler, by Bio-Rad (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Cfx manager software v3, by Bio-Rad (4 mentions)
C1000 touch, by Bio-Rad (3 mentions)
Sypro orange, by Thermo Fisher Scientific (3 mentions)
Cfx manager software, by Bio-Rad (3 mentions)
Minikit rneasy columns, by Qiagen (2 mentions)
Omniscript rt, by Qiagen (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Novostar sybr supermix, by Novoprotein (2 mentions)
Kapa sybr fast qpcr mix, by Roche (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Oligo dt primer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Iscript synthesis kit, by Bio-Rad (1 mentions)
Superscript vilo, by Thermo Fisher Scientific (1 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
Sybr green, by Bio-Rad (1 mentions)
Optical quality sealing tape, by Bio-Rad (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
28 protocols using cfx96 optical reaction module
1
RNA Extraction and qRT-PCR for Hippocampus Samples
2
Thermal Unfolding of Human PAH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thermal unfolding profiles of hPAH were obtained by DSF, in a C1000 Touch thermal cycler with a CFX96 optical reaction module (Bio-Rad; Hercules, CA, USA) as described in [10 (link)]. All assays were carried out in SEC buffer and with Sypro Orange at a 2.5× final concentration. The PCR plates were sealed with Optical-Quality Sealing Tape (Bio-Rad) and centrifuged at 500× g for 5 min. The thermal profiles were obtained by ramping the temperature between 20 and 90 °C at 1 °C/min, with a 1 s hold time every 0.2 °C and fluorescence acquisition through the FRET channel. Data were analysed with CFX Manager Software V3.0 (Bio-Rad) and GraphPad Prism software V6.00 (La Jolla, CA, USA), fitting the experimental curves with a biphasic dose–response function to obtain the hPAH Tms from the midpoint of the first (Tm1) and second (Tm2) transitions.
3
Differential Scanning Fluorimetry of GALT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential scanning fluorimetry (DSF) is a methodology whereby a fluorescent dye binds to the proteins buried hydrophobic residues that become exposed upon thermal unfolding. DSF assays were performed in a C1000 Touch thermal cycler equipped with a CFX96 optical reaction module (Bio-Rad, Hercules, CA), by having the GALT variants at a 0.1 mg/mL (∼2.5 μmol/L in monomer) final concentration in buffer A, SYPRO orange (Invitrogen Corporation, Carlsbad, CA) at a 5× working concentration (Niesen et al. 2007 (link)), in a 50 μL total volume. A 10-min incubation step at 20°C preceded the temperature ramp from 20 to 90°C at 1°C/min, with a 1-sec hold time every 0.2°C and fluorescence acquisition using the HEX channel (excitation maximum at 535 nm, emission maximum at 555 nm). Assays using 2.0 mmol/L Gal-1-P, 0.5 mmol/L UDP-Glc, 100 μmol/L Fe2+, and 100 μmol/L Zn2+ were also performed. Control assays in the absence of protein were routinely performed. Data were processed using CFX Manager software V3.0 (Bio-Rad). Temperature scan curves were fitted to a biphasic sigmoidal function and the Tm values were obtained from the inflexion points of the first and second transitions. Variations in Tm values are considered significant when |ΔTm| ≥ 2°C (above the standard deviation).
4
Muscle Differentiation Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from C2C12 myoblasts and gastrocnemius samples by using TRIzol reagent (15596026, Invitrogen, USA). A total of 1 μg RNA was reverse transcribed into cDNA by using the PrimeScript™ RT Kit (Takara, Kyoto, Japan), and the SYBR Green Real-time PCR Master Mix reagent (Takara, Kyoto, Japan) was used for qPCR. The PCR reactions were carried out on a CFX96™ Optical Reaction Module (Bio-Rad, Hercules, CA, United States). The relative levels of target mRNAs were normalized to that of β-actin through the 2−ΔΔCT method. The primers used are listed in Table 1 .
List of genes, primer sequences in this study
| Gene name | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Myf5 | AAGGCTCCTGTATCCCCTCAC | TGACCTTCTTCAGGCGTCTAC |
| MyoD | CCACTCCGGGACATAGACTTG | AAAAGCGCAGGTCTGGTGAG |
| MyoG | GAGACATCCCCCTATTTCTACCA | GCTCAGTCCGCTCATAGCC |
| MyHC | ACTGTCAACACTAAGAGGGTCA | TTGGATGATTTGATCTTCCAGGG |
| Slc2a6 | AACCGAGGGACTCGACTATGA | CAAGGCATACCCAAAGCTGAA |
| PDHB | CGGTGCAGTTGACAGTTCGT | TCTTCCCCAAGCAGAAAAACTTT |
| LDHA | TGTCTCCAGCAAAGACTACTGT | GACTGTACTTGACAATGTTGGGA |
| LDHB | TGCGTCCGTTGCAGATGAT | TTTCGGAGTCTGGAGGAACAA |
| MCT1 | TGTTAGTCGGAGCCTTCATTTC | CACTGGTCGTTGCACTGAATA |
| MCT4 | TCACGGGTTTCTCCTACGC | GCCAAAGCGGTTCACACAC |
| β-actin | GATCTGGCACCACACCTTCT | GGGGTGTTGAAGGTCTCAAA |
5
Quantifying Keratin Expression in Keratinocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Keratinocytes were grown to confluence in 6-well tissue culture plates. For comparison between cell lines (Figure S1D ), medium was switched from K-SFM to differentiation medium 24 hours before sample collection. For scratch wound experiments (Figure 2C ), culture medium was switched from K-SFM to differentiation medium, then treatment samples were scratched with a 1000 mL pipette tip in a cross-hatch pattern. The scratch procedure was repeated every other day for 10 days. Samples were collected one day following the last scratch procedure. RNA was isolated from the samples using RNeasy spin column kits (Qiagen #74004) and reverse transcription was performed using SuperScript IV First-Strand Synthesis System with oligo(dT)20 primers (Invitrogen #18091050). Real-time PCR using a C1000 thermal cycler with a CFX96 optical reaction module (Bio-Rad), iTaq Universal SYBER Green Supermix (Bio-Rad), and transcript-specific primers (Table S1 ) was performed to quantify transcript levels. The 2−ΔΔCT method12 was used to compare each individual keratin to the mean level of all keratins measured.
6
Quantification of Murine Retinoic Acid Receptor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from purified B cells using MiniKit RNeasy columns (QIAGEN) with a DNase-I treatment step. One microgram of DNA-free RNA was reverse transcribed to cDNA using Omniscript RT (QIAGEN). TaqMan gene expression assays containing FAM dye-labeled TaqMan MGB probe was used for mouse S1pr1 (Mm02619656_s1), RARα (Mm01296312_m1), RARβ (Mm01319677_m1), and RARγ (Mm00441091_m1) in multiplex with primer-limited assays for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) endogenous control containing VIC/MGB probes. Real-time quantification was performed using TaqMan gene expression master mix on a Bio-Rad CFX96 optical reaction module on a C1000 thermal cycler. Data were analyzed using CFX Manager Software (Bio-Rad).
7
Ligand Influence on eIF2B Thermal Stability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of the influence of various ligands on the thermal stability of cteIF2Bα, -β or -δ, the protein was diluted in 96-microplate wells (clear Multiplate 96-well PCR plates, Bio-Rad) to a final concentration of 4 μM in 20 μl total volume. The samples consisted of 50 mM HEPES pH 7.5, 300 mM KCl, 2 mM DTT and 2x SYPRO Orange (diluted from a 5000x SYPRO Orange stock solution, Molecular Probes) and 0–2 mM of various ligands (AMP, ATP, CMP, GMP, GDP, GTP, NADP+, phosphoenolpyruvic acid (PEP), ribose 5-phosphate (R5P), ribulose 1,5-bisphosphate (RuBP), glucose 6-phosphate (G6P), fructose 1,6-bisphosphate (F16BP)). The plates were then sealed with sealing tape (Bio-Rad). Subsequently, samples were subjected to thermal denaturation in a Real Time PCR cycler equipped with a CFX96 optical reaction module (Bio-Rad) by applying a temperature gradient from 293 to 368 K and a ramping rate of 1 K min−1. Protein unfolding was monitored by the increase in the fluorescence of the SYPRO Orange probe, which was recorded using excitation and emission wavelengths of 492 and 516 nm, respectively. The relative fluorescence emission intensity was plotted as a function of the temperature and the Tm for each individual sample was estimated from the inflection point of the melting curve (26 (link)). Experiments were repeated independently 2–3 times.
8
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted as described by Zhao et al. [53 (link)]. The RNA concentration, quality, and integrity were measured by using spectrophotometry (Agilent2100) and gel electrophoresis. The single-stranded complementary deoxyribonucleic acid (cDNA) was synthesized using Prime-Script™ (Takara, Dalian, Code: DRR037A) for qRT-PCR analysis. All the primer sequences were designed using Primer Premier 6.0 and the selected Unigene IDs are detailed in the additional file (see Additional file 12 : Table S7). The qRT-PCR assays were performed by using a CFX96™ optical reaction module (Bio-RAD, USA) and the detailed detection system was the same as previously described by Zhao et al. [53 (link)]. The resultant relative expression values were normalized against the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and evaluated from the mean value of three biological and three technical replicates by the 2-ΔΔCT method [68 (link)].
9
Osteogenesis Quantified by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed twice with PBS, and total RNA was extracted by PureLink™ RNA Mini Kit according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). Total RNA was subjected to reverse transcription and then qRT-PCR using SYBR green on CFX96 Optical Reaction Module (Bio-Rad, Hercules, CA, USA). Primer sets used to quantify osteogenic differentiation [26 (link)] are listed in Table S2 .
10
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples using a Plant Total RNA Extraction kit (Tiangen, Beijing, China). First-strand cDNA was synthesized from 1 µg total RNA using a Reverse Transcription Kit with Genomic DNA Remover (Takara, Kusatsu, Japan). Real-time quantitative PCR was performed on a CFX96™ Optical Reaction Module (Bio-Rad, Hercules, CA, USA) using Novostar-SYBR Supermix (Novoprotein, Suzhou, China) according to the manufacturer’s instructions. GhHISTONE3 was used as an internal control. Each analysis was repeated with three biological replicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!