Total RNA was extracted using an RNeasy plus kit (Qiagen) and ≤ 1 μg of RNA was used to synthesize cDNA (Applied Biosystems). TaqMan® RT-PCR was performed using the following TaqMan® Gene Expression Assays: IL-1β (Mm01336189_m1), chemokine receptor 5 (CCR5: Mm01216171_m1), chemokine receptor 2 (CCR2: Mm00438270_m1), chemokine ligand 10 (CXCL10; Mm00445235_m1), complement component 5a receptor 1 (C5AR1; Mm00500292_s1), CD274 (PD-L1) (Mm00452054_m1), CD200 receptor 1 (CD200R1: Mm02605260_s1), NLRP3 (Mm00840904_ml), NLRC4 (Mm01233149_ml), glutamate-cysteine ligase, modifier subunit (GCLM; Mm00514996_ml), glutamate-cysteine ligase, catalytic subunit (GCLC: Mm00802655_ml) and haem oxygenase 1 (HMOX1; Mm00516005_ml), all from Applied Biosystems. Polymerase chain reactions were performed in triplicate in a StepOne sequence detector (Applied Biosystems). Data analysis was performed using the Applied Biosystems sequence detection software and samples were normalized to the reference reporter mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Mm99999915_g1) endogenous control.
Stepone sequence detector
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada
The StepOne sequence detector is a real-time PCR instrument designed for gene expression analysis and genetic variation detection. It utilizes fluorescence detection technology to monitor the amplification of DNA samples during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Maxima sybr green qpcr master mix, by Thermo Fisher Scientific (3 mentions)
Rneasy plus kit, by Qiagen (2 mentions)
Mircury lna universal rt microrna pcr kit, by Qiagen (2 mentions)
Microrna lna pcr primer set, by Qiagen (2 mentions)
Sybr green master mix, by Qiagen (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Nlrp3, by Thermo Fisher Scientific (1 mentions)
Cd274 pd l1, by Thermo Fisher Scientific (1 mentions)
Hmox1, by Thermo Fisher Scientific (1 mentions)
T18 ultra turrax homogenizer, by IKA Group (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Stepone software version 2, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
11 protocols using stepone sequence detector
1
Quantifying Immune Response Markers in Mice
2
Comparative Analysis of miRNA Expression in Fracture Healing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For further analysis of the array results, we selected miRNAs that were highly up-regulated in the standard healing fracture group. To compare the expression levels of the selected miRNAs between standard healing fractures and unhealing fractures and to investigate their changes in expression over time in standard healing fractures, real-time PCR was performed on RNA from tissue specimens collected on post-fracture days 3, 7, 10, 14, 21, and 28 (n = 5 in each group at each time point). Tissue specimens were homogenized with a T 18 ULTRA-TURRAX homogenizer (IKA Werke, Staufen, Germany) and total RNA, including miRNAs, was extracted using a miRCURY RNA Isolation Kit-Tissue. RNA used for real-time PCR assays did not include any of the RNA used in the microarray assay. Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon). Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green master mix and microRNA LNA PCR primer sets (both from Exiqon). U6 was used as an internal control to normalize differences in miRNA levels in each sample. The relative abundance of each miRNA was calculated using the comparative ΔΔCT method, and is presented as the fold change relative to levels in the post-fracture day 3, standard healing fracture sample.
3
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cell lysates and plasma were extracted using Trizol® and Trizol® LS reagent (Life Technologies) respectively, according to the manufacturer's instructions [29 (link)]. For detection of miRNA expression, the expression levels of specific miRNAs were detected using the stem-loop strategy described in a previous study [30 (link)]. The specific primers for each miRNAs are listed in S1 Table . In order to measure gene expression, cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). All the specific products of the miRNAs and genes were detected using Maxima™ SYBR Green qPCR Master Mix (Thermo Scientific) on a StepOne™ sequence detector (Applied Biosystems, USA). The miRNA expression levels from the ECFCs and plasma were normalized against U48 and miR-16, respectively [27 (link), 31 (link)]. The mRNA expression levels were normalized against average GAPDH level.
4
Quantitative Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and RT-qPCR were performed as described [12] (link). Total RNA was extracted using Tri Reagent (Sigma-Aldrich Co., St. Louis, USA) according to the manufacturer's instructions. For miRNA qPCR, the expression levels of specific miRNAs were detected using stem-loop RT-PCR [21] (link). The universal PCR reverse primer for the miRNAs was 5′-GTGCAGGGTCCGAGGT-3′ . Amplification of marker genes was performed using specific primers, Maxima SYBR Green qPCR Master Mix (K0222, Fermentas) and a StepOne sequence detector (Applied Biosystems, USA). Designed primers for each miRNAs are listed in Table S1 ; endogenous U6 and miR-16 were used as an internal control for normalizing miRNA expression in cells and plasma respectively [12] (link). The VEGF mRNA expression data were normalized to the average value of GAPDH and beta-actin.
5
Quantitative EBV DNA Detection from Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from cryopreserved pretreatment serum using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. The EBV DNA load was quantified by means of a StepOne sequence detector (Applied Biosystems, Foster City, CA, USA). In brief, DNA samples were mixed with the primers and the TaqMan probe and amplified using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems). Primer sequences were based on the BALF5 gene encoding the DNA polymerase of EBV (5′‐CGGAAGCCCTCTGGACTTC‐3′, 5′‐CCCTGTTTATCCGATGGAATG‐3′), and the probe sequence corresponded to a region between the primers (5′‐TGTACACGCACGAGAAATGCGCC‐3′). The EBV DNA load for each sample was calculated automatically by StepOne software version 2.2.2 (Applied Biosystems). A positive control of DNA from the Namalwa cell line and a negative control of water blanks were included in each analysis.
6
Quantitative RT-PCR Analysis of miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
About 106 cells were added to 1 mL Trizol (Invitrogen, Carlsbad, CA, USA) to extract total RNA. Total RNA (1 μg) was taken for reverse transcription using a SuperScript III Reverse Transcriptase kit with an oligo (dT) primer (Invitrogen). Expression of mature mouse miRNAs was determined by a stem-loop real-time PCR system using Maxima SYBR Green quantitative PCR Master Mix (Fermentas, Ontario, Canada) and StepOne Sequence Detector (Applied Biosystems, Foster City, CA, USA). The mmu-miR-30a-F2 primer was 5′-ACAGCCTGTAAACATCCTCG -3′ and the mmu-miR-30a-RT primer was 5′-GTCGTATCCAGTGCAGGG TCCGAGGTATTCGCACTGGATACGACTTCCAGT-3′. PCR primers for U6 were 5′-CTCGCTTCGGCAGCACATATACT-3′ and 5′-ACGCTTCACGAATTT GCGTGTC-3′. The universal primer downstream (mir-R2) was 5′-TCGTATCCAGT GCAGGGTC-3′. Data were normalized from control or I-R group (100 %) and expressed as a percentage of the control or I-R group.
7
Temporal Profiling of Fracture-induced miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the array results, five types of miRNA were selected for further real-time PCR analysis. Real-time PCR was performed on RNA from the newly generated callus collected on post-fracture days five, seven, 11, 14, 21, and 28 (n = 6 in each group at each timepoint). Tissue specimens were homogenized and total RNA was extracted. RNA was reverse-transcribed into single-strand complementary DNA using the miRCURY locked nucleic acid (LNA) Universal RT microRNA PCR kit (Exiqon A/S, Vedbaek, Denmark). Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems Inc., Foster City, California), using SYBR Green master mix and microRNA LNA PCR primer sets (both from Exiqon A/S, Vedbaek, Denmark). U6, a small nuclear RNA, was used as an internal control to normalize differences in miRNA levels in each sample.9 (link),12 (link) The relative abundance of each miRNA was calculated using the comparative ΔΔCT method9 (link),12 (link) and is presented as the fold change relative to levels in the post-fracture day five control sample.
8
Plasma miRNA Levels in Stroke Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in heparinized tubes and centrifuged at 2000 ×g for 10 min. Plasma miR-181c and -181d levels of stroke patients and healthy subjects were detected by RT-PCR. Total RNA was isolated by adding 1 ml TRIzol reagent (Invitrogen, Carlsbad, CA, USA) to 300 μl plasma; 50 ng of RNA were reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen) with miRNA RT primer (GenePharma, Shanghai, China). The expression of mature human miRNAs was determined by a stem-loop RT-PCR system using Maxima SYBR Green qPCR Master Mix (Fermentas, Burlington, Canada) and a StepOne sequence detector (Applied Biosystems, Foster City, CA, USA). MiRNA levels were normalized to that of U6 and were calculated as the inverse log of the cycle threshold to determine the relative fold change in miRNA gene expression level. Forward and reverse primers used for RT-PCR were as follows: hsa-miR-181c: 5’-TTCTTCAACATTCAACC TGTCG-3’ and 5’-TATCGTTGTACTCCAGACCA AGAC-3’; hsa-miR-181d: 5’-CTCATAAACATTCATT GTTGTC GG-3’ and 5’-CTCATAAACATTCAT TGTTGTCGG-3’; U6: 5’-ATTGGAACGATACAGAG AAGATT-3’ and 5’-GGAACGCTTCACGAATTTG-3’.
9
Quantitative RT-PCR Analysis of Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNeasy Fibrous kit (Qiagen) and ≤1 µg of RNA was used to synthesise cDNA (Applied Biosystems). TaqMan® RT-PCR was performed using the following TaqMan® Gene Expression Assays: IL-17A (Mm00439619_m1), IFNγ (Mm01168134_m1), IL-4 (Mm00445259_m1), IL-22 (Mm01226722_g1), TNFα (Mm00443259_g1) and IL-6 (Mm00446190m1), all from Applied Biosystems. Polymerase chain reactions were performed in duplicate in a StepOne sequence detector (Applied Biosystems). Data analysis was performed using the Applied Biosystems sequence detection software and samples were normalised to the reference reporter mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Mm99999915_g1) endogenous control.
10
Fracture Callus miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the array results, the top four miRNAs on days 5 and 11 were selected for further real-time PCR analysis. The newly generated calluses collected on post-fracture days 5, 7, 11, 14, 21, and 28 were harvested (n = 6 per group at each time point). The calluses were homogenized, and total RNA was extracted. RNA was reverse-transcribed to single-stranded cDNA using the miRCURY LNA Universal RT microRNA PCR Kit (Exiqon, Vedbaek, Denmark). Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green Master Mix and microRNA LNA PCR primer sets (both from Exiqon). As an internal control gene in miRNA PCR assays, U6 was used [13 (link), 14 (link)]. The conditions of the PCR amplification were 95 °C for 30 sec, followed by 40 cycles of 95 °C for 30 sec and 75 °C for 15 sec. Changes in miRNA expression levels were calculated using the comparative ΔΔCT method [13 (link), 14 (link)] and is presented as the fold change relative to the level of the corresponding miRNA in the control group on post-fracture day 5.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!