AsA and DHA were measured according to the method described by An et al. [34 ]. For qRT-PCR validation, 11 cDNAs encoding GDP-mannose-3',5'-epimerase (GME), GDP- L-galactose-1-phosphate phosphorylase (GGP), L-galactose-1-phosphate phosphatase (GPP), L-galactose dehydrogenase (GDH), L-galactono-1,4-lactone dehydrogenase (GLDH), D-galacturonate reductase (GUR), myo-inositol oxygenase (MIOX), AAO, APX, DHAR, and MDHAR proteins, all of which have potential roles in AsA metabolism, were selected. Target gene primers were designed (S1 Table ) according to acquired sequences using the Primer Express software (Applied Biosystems, USA). Total RNAs were extracted from R. roxburghii leaves at a leaf age of 10 days while fully expanding, 50-day-old leaves were labeled as mature, and 90-day-old leaves were designated as aged, using the TRIzol reagent (Invitrogen), followed by purification with an RNA purification kit (Takara). qRT-PCR and subsequent data analysis was performed according to the method described by Yan et al. [9 (link)].
Rna purification kit
Manufactured by Takara Bio
Sourced in Japan
The RNA Purification Kit is a laboratory product designed for the extraction and purification of RNA from various biological samples. It utilizes a simple and efficient process to isolate high-quality RNA that can be used for downstream applications such as RT-PCR, Northern blotting, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Primer express software, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Reverse transcriptase kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Qpcr mix, by Takara Bio (1 mentions)
Exosome rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Sybr green mix kit, by Bio-Rad (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
5 protocols using rna purification kit
1
Quantitative Analysis of Ascorbate Metabolism
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol® (Thermo Fisher Scientific), and cDNA was synthesized using the Takara RNA Purification Kit according to the manufacturer's protocol. The amplification conditions were as follows: 95°C for 3 min, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. The experiment was concluded using the melt curve procedure. Relative expression was evaluated using the 2-ΔΔCq method as the following: 2−△△Cq = 2^[−(△Cqcontrol△Cqtest)]. RT-qPCR was performed using the following primers:
ACTB forward, 5′-GTGGCCGAGGATTTGATTG-3′ and reverse, 5′-CCTGTAACAACGCATCTCATATT-3′; GAPDH forward, 5′-AGCCACATCGCTCAGACAC-3′ and reverse, 5′-GCCCAATACGACCAAATCC-3′; VEGF forward, 5′-TAGAGTACATCTTCAAGCCGTC-3′ and reverse, 5′-CTTTCTTTGGTCTGCATTCACA-3′; HSP90 forward, 5′-ACGAAGCATAACGACGATGAGCAG-3′ and reverse, 5′-CCATTGGTTCACCTGTGTCAGTCC-3′.
ACTB forward, 5′-GTGGCCGAGGATTTGATTG-3′ and reverse, 5′-CCTGTAACAACGCATCTCATATT-3′; GAPDH forward, 5′-AGCCACATCGCTCAGACAC-3′ and reverse, 5′-GCCCAATACGACCAAATCC-3′; VEGF forward, 5′-TAGAGTACATCTTCAAGCCGTC-3′ and reverse, 5′-CTTTCTTTGGTCTGCATTCACA-3′; HSP90 forward, 5′-ACGAAGCATAACGACGATGAGCAG-3′ and reverse, 5′-CCATTGGTTCACCTGTGTCAGTCC-3′.
3
Gene Expression Assessment in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the level of gene expression of tight junction protein-1 (ZO-1), occludin, TNF-α, interleukin-1β (IL-1β), IL-10, fibroblast growth factor 15 (Fgf15), cholesterol 7α-hydroxylase (CYP7A1), sterol 12α-hydroxylase (CYP8B1), small heterodimer partner (SHP) and bile salt export pump (BSEP), the liver, ileum and colon tissues of the animals were collected. Total RNA was extracted from 20 mg of tissue using an RNA Purification Kit (Takara Bio, Inc., Otsu, Shiga, Japan) according to the manufacturer’s protocol. RNA concentration was measured with the NanoDropND1000 (NanoDrop, Wilmington, DE, USA). cDNA was generated from total RNA using a Reverse Transcriptase Kit (Takara Bio, Inc., Otsu, Shiga, Japan). Then, 1 mg of RNA was used for measuring target gene expression by reverse transcription quantitative real-time PCR (RT-qPCR). The forward and reverse primers of the target genes are listed in Table S1 . The RT-qPCR reaction was performed using SYBR premix Ex Taq (Takara Bio, Inc., Otsu, Shiga, Japan). The reaction mixture was incubated for 300 sec at 95 °C, followed by 35 amplification cycles of 30 sec at 95 °C, 30 sec at 60 °C, and 30 sec at 72 °C, on an ABI PRISM 7,500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Cycle threshold (Ct) values of all samples were normalized using the 2−ΔΔCt method. Each qPCR assay was performed in triplicate.
4
Investigating miR-19b-3p and SLC7A11 in Cartilage and Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cartilage tissues, FLSs, and chondrocytes was isolated with RNA Purification Kit (Takara, China). The RNA of FLS exosomes was extracted using an Exosome RNA Isolation Kit (Invitrogen, USA). The RT-qPCR was performed using Reverse Transcription Kit (Takara, China) and qPCR Mix (Takara, China) according to the kit’s instructions. The miR-19b-3p and SLC7A11 expression was assessed using the 2-ΔΔCt method and normalized to U6 or β-actin. The primer sequences used in the study were as follows (5’–3’): miR-19b-3p (forward, TCTACAGGTGTGCAAATCCATG; reverse, TGTCGTGGAGTCGGCAATTC); U6 (forward, CGCTTCGGCAGCACATATACTA; reverse, ATGGAACGCTTCACGAATTTGC); SLC7A11 (forward, TGCTGGGCTGATTTTATCTTCG; reverse, GAAAGGGCAACCATGAAGAGG); β-actin (forward, TGGTATCGTGGAAGGACTC; reverse, AGTAGAGGCAGGGATGATG).
5
Quantifying lncRNA LSINCT5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from EOC tissues and human ovarian cancer cell lines using Trizol reagent (Takara Bio, Inc., Otsu, Japan) and purified using an RNA Purification kit (Takara Bio, Inc.). Reverse transcription was performed using PrimeScript RT master Mix (Takara Bio, Inc.). qPCR was performed using a SYBR-Green MIX kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The primer sequences used for human LSINCT5 are as follows: Forward, 5′-CCAGCUACAAACCUCUGAATT-3′, and reverse, 5′-UUCAGAGGUUUGUAGCUGGTT-3′. GAPDH (sequences: Forward, 5′-AGGGCTGCTTTTAACTCTGGT-3′, and reverse, 5′-CCCCACTTGATTTTGGAGGGA-3′) was used as an internal standard, the relative expression of each gene was normalized to GAPDH. PCR cycling conditions were as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 20 sec and 72°C for 20 sec. Relative quantification of mRNA was performed using comparative threshold cycle (CT) method. This value was used to plot the gene expression employing the formula 2−ΔΔCq (12 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!