RNA and cDNA were prepared using standard techniques. qPCR was performed in triplicates using the Universal Probe Library system (Roche) or SyberGreen (QIAGEN) and a LightCycler 480 (Roche). Transcript quantities were calculated relative to standard curves and normalized to β-actin, Igβ, or hypoxanthine-guanine phosphoribosyltransferase (HPRT) mRNA. See Table S3 for primers and probes used in this study.
Sybergreen
Manufactured by Qiagen
Sourced in Germany
SyberGreen is a fluorescent dye used in qPCR (quantitative Polymerase Chain Reaction) assays to detect and quantify DNA. It binds to double-stranded DNA, allowing real-time monitoring of DNA amplification during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (3 mentions)
Universal probe library system, by Roche (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Rnase free dnase 1, by Qiagen (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Superscript vilo master mix, by Thermo Fisher Scientific (1 mentions)
Nucleospin rna, by Macherey-Nagel (1 mentions)
Quantitect, by Qiagen (1 mentions)
5 protocols using sybergreen
1
Quantitative Real-Time PCR Analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction (QIAGEN, 74106) and cDNA (ThermoFisher Scientific, 12574026) were prepared as per the manufacturer’s instructions. qPCR was performed in triplicate using SyberGreen (QIAGEN, 204143) and a LightCycler 480 (Roche, 05015278001) as previously described (Pankotai et al., 2012 (link)). Relative quantification of transcript quantities were calculated from standard after normalizing it to β-ACTIN (U2OS) and GAPDH (MCF7) mRNA (see Table-S3 for primers).
3
Profiling Gene Expression in Leukemia Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mCherry+ leukemia cells, bone marrow stromal cells (CD45-Ter119-), B cells (B220+), and pre-B cells (CD19+CD24+BP-1+IgM-) using RNeasy Mini Kit or RNeasy Micro Kit with RNase-free DNase I (Qiagen, Hilden, Germany). cDNA was synthesized using SuperScript VILO Master Mix (Thermo Fisher Scientific). Quantitative PCR was performed on an ABI 7900HT thermocycler using Taqman Gene Expression Assays (Thermo Fisher Scientific) for mouse Rankl (Mm00441906_m1), Csf1 (Mm00432686_m1), Opg (Mm00435454_m1), Pax5 (Mm00435501_m1) as well as Hprt (Mm03024075_m1), and SYBER Green (Qiagen) with the following specific primer set: osteocalcin F: GCGCTCTGTCTCTCTGACCT, osteocalcin R: ACCTTATTGCCCTCCTGCTT, Hprt F: GCAGTACAGCCCCAAAATGG, Hprt R: AACAAAGTCTGGCCTGTATCCAA. Relative expression was calculated using the ΔΔCT method normalized to Hprt levels for each individual sample measured in duplicate.
4
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction (QIAGEN, 74106) was performed according to the manufacturer’s instructions. RT qPCR was performed in triplicate using SyberGreen (QIAGEN, 204143) and a LightCycler 480 (Roche, 05015278001) as previously described (Pankotai et al., 2012 (link)). Relative quantification of transcript quantities were calculated from standard after normalizing it to GAPDH mRNA (for primers see Table S2 ).
5
Total RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated (NucleoSpin RNA; Macherey-Nagel, Duren, Germany) and retro-transcribed into complementary DNA (Bio-Rad, Hercules, CA). Gene expression was measured by real-time polymerase chain reaction (Bio-Rad) with SyberGreen and Quantitect primers (Qiagen, Hilden, Germany). Gene expression was normalized to HPRT expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!