HeLa cells (ATCC) were grown under standard tissue culture conditions (37°C, 5% CO2) in MEM+Glutamax (GIBCO), 10% FBS, 1% non-essential amino acids and 1% sodium pyruvate. Cells were transfected with siRNA (Sigma) against 3′ UTR of MRE11 or luciferase as control (Table S1 ) in complete media for 48 h with the standard protocol for RNAimax. These cells were then transfected with 1 μg of either mammalian ER-I-PpoI-expressing plasmid (Berkovich et. al., 2007 (link)) or empty vector with the standard protocol for Lipofectamine 2000 (Invitrogen). In the experiment where mutants of MRE11 were expressed, pICE-HA-MRE11-WT, pICE-HA-MRE11-H129N, pICE-HA-MRE11-H63D and pICE-HA-MRE11- H63S (Addgene, Chanut et al., 2016 (link)) were co-transfected. The knockdowns and expression of MRE11 mutants was confirmed by immunoblotting. The nuclear translocation of I-PpoI was activated 24 h later by supplementing the media with 4-OHT, 2 μM for 3 h. Cells were harvested, washed and total RNA was extracted using Maxwell® RSC simplyRNA Blood Kit (Promega). RNA was quantified using Nanodrop (Thermoscientific) and 1 μg of total RNA was reverse transcribed using Superscript First strand cDNA synthesis kit with strand-specific primers (Table S1 ). RT-qPCR was used to determine the expression of DSB-induced transcripts using Evagreen supermix (Bio-Rad).
Superscript first strand cdna synthesis kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The SuperScript First-Strand cDNA Synthesis Kit is a laboratory reagent used for the reverse transcription of RNA into complementary DNA (cDNA). It provides the necessary components, including reverse transcriptase enzyme, primers, and buffers, to facilitate the conversion of RNA into single-stranded cDNA for subsequent use in various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (27 mentions)
Nanodrop, by Thermo Fisher Scientific (12 mentions)
Dnase 1, by Thermo Fisher Scientific (10 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (8 mentions)
Lightcycler 480 system, by Roche (8 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (5 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Turbo dnase, by Thermo Fisher Scientific (4 mentions)
Sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (4 mentions)
Evagreen supermix, by Bio-Rad (3 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Sybr green, by Thermo Fisher Scientific (3 mentions)
Ambion microbexpress bacterial mrna enrichment kit, by Thermo Fisher Scientific (3 mentions)
Fastrna pro blue kit, by MP Biomedicals (3 mentions)
Lightcycler 480, by Roche (3 mentions)
Rneasy kit, by Qiagen (3 mentions)
100 protocols using superscript first strand cdna synthesis kit
1
Dissecting MRE11 Function in DSB Response
2
Quantitative Analysis of Cancer Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA level of KSP, DTL, caspase-3, and Bax of breast cancer cells were determined by real-time reverse-transcription PCR analysis. Briefly, total RNA was isolated using the RNeasy method according to the manufacturer’s protocol 25 (link). Total RNA (2 μg) from each sample was subjected to reverse transcription using the superscript first-strand cDNA synthesis kit (Thermo Scientific, Waltham Massachusetts, USA) according to the manufacturer’s instructions. Real-time PCR reactions were then carried out in a total of 15 µl reaction mixture: 2.5 µl of cDNA, 7.2 µl of 2× SYBR Premix Ex Taq [TaKaRa Biotechnology Co. Ltd (Dalian, China)], 0.3 µl of ROX-II, 1.0 µl of each 10 µmol/l forward and reverse primers, and 4.0 µl of H2O. The PCR program was initiated by 30 s at 95°C before 40 thermal cycles, each for 3 s at 95°C and 30 s at 60°C. Data were analyzed using the comparative Ct method and were normalized by β-actin expression in each sample. The sequences of PCR primers for KSP, DTL, caspase-3, and Bax are listed in Table 1 .
3
NNAT mRNA Isoform Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from cultured cells with the 5PRIME PerfectPure RNA Blood kit (ThermoFisher, Waltham, MA, USA) and was reverse transcribed (SuperScript First Strand cDNA synthesis kit, ThermoFisher, Waltham, MA, USA). End point PCR was performed as described previously [14 (link)] using primers which amplify both NNAT mRNA isoforms NNATα (262 bp) and NNATβ (181 bp). Duplicate reactions were amplified with primers for the ubiquitously-expressed SNRPD3 gene (500 bp). DNA was electrophoretically separated with a 2% Agarose gel with gel red and detected under ultraviolet light.
4
Cytokine and Gene Expression Analysis in Murine Lung
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from left lung samples using TRIzol™ Reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to cDNA by using the Superscript First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. A quantitative analysis of the relative mRNA expression of different cytokines (TNF-α, IL-6, IL-1β, IL-10 and TGF-β), HMGB1, TLR2 and MyD88 in murine lung tissues were determined in triplicate using SYBR Green Super Mix Kit (Takara Bio Inc., Tokyo, Japan) on a Roche LightCycler® 96 real-time PCR system (Roche Molecular Systems, Inc., USA). The relative mRNA expression was calculated with the comparative △Cq method using the formula 2−△△Cq compared to GAPGH housekeeper gene control. The primers listed in Table 2
5
Comprehensive qRT-PCR Analysis of RNAi-Mediated Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the RNAi-transfected HCC cells using TRIZOL (Invitrogen, CA, USA). The 2 μg of total RNA was collected and randomly primed to synthesize the complementary DNA (cDNA) using the SuperScript First Strand cDNA Synthesis kit (K1622) (Thermo Fisher Scientific, Waltham, MA, USA) as per the manufacturer’s protocol. Following, we performed the qRT-PCR using Step One plus qRT-PCR system (Life Technologies, Burlington, ON, Canada) with SYBR™ Green Master Mix—Real-Time PCR Master Mix (Applied Biosystems, Waltham, MA, USA) to analyze the miR-221, AEG-1, LSF, MMP9, p57, p53, RB, OPN, PTEN, Bcl-2, PI3K, Akt, and LC3A mRNA expressions. The primers were purchased from Eurofins Genomics (Louisville, KY, USA) and listed in Supplementary Table S1 . The U6 snRNA and GAPDH were internal controls for miR-221 and AEG-1. The data was collected, and the specificity of the primers was verified by melt curve analysis. The fold changes of miR-221 and mRNAs were calculated using the 2−ΔΔCt method.
6
RNA Extraction and cDNA Synthesis from Parasites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tfBbo5480 and WT parasites using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol, and the RNA pellets were suspended in 20 µL DEPC-treated water. RNA samples were treated with DNase I (Thermo Fisher Scientific) following the manufacturer’s protocol to remove contaminating genomic DNA and quantified by Nanodrop (Thermo Fisher Scientific). The removal of genomic DNA was confirmed by PCR targeting rap-1 as previously described [31 (link)]. cDNA was synthesized from 100 ng of total RNA from each sample with a Superscript® First-strand cDNA synthesis kit (Thermo Fisher Scientific) with (RT+) and without (RT-) enzyme following the manufacturer’s protocol.
Reverse transcription polymerase chain reactions (RT-PCR) were performed from cDNA samples using primer sets (Table 1 ). PCR cycling conditions consisted of 95 °C for 3 min followed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min, with a final extension of 72 °C for 5 min. PCR products were visualized by 1% agarose gel electrophoresis. PCR amplicons were cloned into PCR 2.1-TOPO® and submitted for sequencing (Eurofins MWG Operon).
Reverse transcription polymerase chain reactions (RT-PCR) were performed from cDNA samples using primer sets (
7
Molecular Characterization of Renal Calcium Homeostasis
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Organoid total RNAs were isolated using Trizol reagent (ThermoFisher), following manufacture's instruction. Isolated RNA was reversed transcript to first strand cDNA using a SuperScript first strand cDNA synthesis kit (ThermoFisher, Catalog # 11904018). The cDNAs were used for quantitative polymerase chain reaction (qPCR).
Primers for qPCR were designed with Primer-BLAST (35) . The primers for fibrotic gene qPCR are listed in Supplemental Table 2. qPCR was performed in a Quantstudio 6 thermocycler (ThermoFisher) and using the qPCR reagents (Agilent Technologies, Cat# 600882). GAPDH served as normalizing gene and the relative mRNA levels of target genes were calculated by 2 -ΔΔCT method, and expressed as mean ± SD.
Primers for qPCR were designed with Primer-BLAST (35) . The primers for fibrotic gene qPCR are listed in Supplemental Table 2. qPCR was performed in a Quantstudio 6 thermocycler (ThermoFisher) and using the qPCR reagents (Agilent Technologies, Cat# 600882). GAPDH served as normalizing gene and the relative mRNA levels of target genes were calculated by 2 -ΔΔCT method, and expressed as mean ± SD.
9
Quantitative Expression Analysis of Rbl2/p130 in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from tissues (tumor + ANCT) was carried out using standard Trizol method [29 ] with slight modifications as per requirement. RNA was stored and at -80°C until further analysis. Reverse transcription polymerase chain reaction (RT-PCR) was carried out using super script first-strand cDNA synthesis kit (Invitrogen, USA). Gene specific primers for Rbl2/p130 (Left primer; AGAGGATGCTGAGGAGGAAA, Right primer; CAATAGCCTGGGTTGGATCT) and β-actin (internal control) (Left primer; CACTCTTCCAGCCTTCCTTC, Right primer; TGATCTCCTTCTGCATCGTG) were used for quantitative real time PCR analysis using Syber dye base approach. qPCR was performed on Step One Plus Real-Time PCR system (Applied Biosystems). Thermo-cycler conditions were 95°C for 10 min (initial denaturation) followed by 40 cycles of 95°C for 15 seconds, 54°C for 60 seconds and 72°C for 20 seconds with a final extension of 72°C for 1 min and the results were interpreted using their delta delta ct values.
10
Quantification of Auxin-Responsive Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For treatments with exogenous indole acetic acid (IAA; Supplemental Figure S2 ), 7- to 8-d-old seedlings grown on MS agar medium were transferred to MS liquid medium containing either IAA (10 µM) or DMSO (0.1%) and were treated for 3 h. Expression of auxin-responsive genes was determined by RT-qPCR analysis. Total RNA was isolated using TRI reagent following the manufacturer’s protocol (Ambion). We used 1 µg of RNA to make cDNA using SuperScript first-strand cDNA synthesis kit (Invitrogen). Amplification was performed using Power SYBR Green Master Mix (Applied Biosystems) and the ABI Prism 7500 sequence detection system (Applied Biosystems). EIF-4A2 (At1g54270) was used to normalize the expression and fold changes were calculated following the ΔΔCT method (Livak and Schmittgen, 2001 (link)). Expression values are plotted relative to the WT (set to 1). Statistically significant differences were determined by two-sample Student’s t test (P ≤ 0.01 as indicated).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!