Total RNA was isolated from 70 to 90% confluent cells using QIAzol Lysis Reagent (Cat. #: 79306, QIAGEN, Hilden, Germany) according to the manufacturer’s recommendations. Subsequently, 1 μg of total RNA was reversely transcribed with the miScript II RT Kit (Cat. #: 218161, QIAGEN, Hilden, Germany) using the miScript HiFlex buffer to enable quantification of both miRNA and mRNA. qPCR was performed on the LightCycler 480 (Roche, Basel, Switzerland) using the QuantiTect SYBR Green PCR Kit (Cat. #: 204145, QIAGEN, Hilden, Germany). For the quantification of miR-200c-3p, the Hs_miR-200c_1 miScript Primer Assay (Cat. #: MS00003752, QIAGEN, Hilden, Germany) and Hs_RNU6-2_11 miScript Primer Assay (Cat. #: MS00033740, QIAGEN, Hilden, Germany) were used, with RNU6-2 serving as a reference gene. For mRNA quantification, expression levels of Keratin 8 (KRT8), E-cadherin (CDH1), N-cadherin (CDH2), Collagen Type III Alpha 1 Chain (COL3A1), Vimentin (VIM), zinc finger E-box binding homeobox 1 (ZEB1), zinc finger E-box binding homeobox 2 (ZEB2), and genes that have previously been associated with cisplatin resistance (see Table S1 ) were normalized to the mean expression of GAPDH and U6. Primer sequences are listed in Table S2 . Differences in gene expression were evaluated by the ΔΔCt method.
Hs rnu6 2 11 miscript primer assay
Manufactured by Qiagen
Sourced in Germany
The Hs_RNU6-2_11 miScript Primer Assay is a laboratory equipment product designed for the detection and quantification of the RNU6-2 small nuclear RNA (snRNA) in human samples. This assay is part of the miScript Primer Assay product line from Qiagen, which are designed to facilitate the study of microRNA expression.
Automatically generated - may contain errors
Lab products found in correlation
Miscript 2 rt kit, by Qiagen (4 mentions)
Miscript sybr green pcr kit, by Qiagen (3 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Quantitect sybr green pcr kit, by Roche (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Lightcycler 480 sybr green 1 master, by Roche (1 mentions)
Stepone real time pcr system, by Qiagen (1 mentions)
Rt2 qpcr primer assay for human gapdh, by Qiagen (1 mentions)
Real time pcr system, by Thermo Fisher Scientific (1 mentions)
Mirneasy micro kit, by Qiagen (1 mentions)
Rt2 first strand kit, by Qiagen (1 mentions)
Rt2 sybr green rox qpcr mastermix, by Qiagen (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
Mirnaeasy kit, by Qiagen (1 mentions)
7 protocols using hs rnu6 2 11 miscript primer assay
1
Quantification of miRNA and mRNA Expression
2
Gene expression analysis in tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heart, kidney and liver tissues were dissected at 7 dpi, 14 dpi and 28 dpi time-points, snap-frozen in liquid nitrogen and stored at −80 °C. RNA was extracted with miRNeasy mini kit (Qiagen, Hilden, Germany) or RNeasy mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. One hundred and fifty ng of total RNA was converted to cDNA with miScript II RT kit (Qiagen, Hilden, Germany) or Superscript Vilo cDNA synthesis kit (Invitrogen, Carlsbad, California, United States). The let-7c gene was amplified with miScript SYBR Green PCR kit (Qiagen, Hilden, Germany) and Hs_let-7c_1 miScript Primer Assay (Qiagen, Hilden, Germany) using Hs_rnu6-2_11 miScript primer assay (Qiagen, Hilden, Germany) as internal control. Other genes, plasminogen activator inhibitor-1 (pai-1), retinaldehyde dehydrogenase 2 (raldh2), collagen 12a1a (col12a1a) and periostin (postna) were amplified with LightCycler 480 SYBR Green I Master (Roche, Basel, Switzerland) using rps3 as internal control; all primer sequences are listed in Table 1 . LightCycler480 II (Roche, Basel, Switzerland) was used for real-time PCR and the expression levels were quantified by the ΔΔCT method.
3
RNA Extraction and Real-time qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from MDA231 and MDA231-BrM2 cells was extracted using the miRNeasy Micro Kit (cat# 217084, Qiagen, Germany). A NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) was used to evaluate RNA purity and concentration using two absorbance ratios (A260/A280 and A260/A230). For single-stranded cDNA synthesis, the RT2 First Strand Kit (cat#, 330401, Qiagen) or the miScript II RT Kit (cat#, 218161, Qiagen) was used as per the manufacturer’s protocols. Real-time quantitative PCR was performed on the “Applied Biosystems® StepOne™ Real-Time PCR System” with the RT2 SYBR Green ROX qPCR Mastermix (cat# 330522, Qiagen) for mRNA expression and the miScript SYBR Green PCR Kit (Cat# 218075, Qiagen) for miRNA expression using the “Applied Biosystems® StepOne™ Real-Time PCR System”.13 (link) hsa-miR-623 and MMP1 relative expressions were normalized to the housekeeping gene U6 small nuclear RNA and GAPDH (glyceraldehyde-3-phosphate dehydrogenase), respectively, and the data were analyzed using the 2–ΔCt and 2–ΔΔCt methods.34 (link) The primers used were obtained from Qiagen: Hs_miR-623_1 miScript Primer Assay (Qiagen), Hs_RNU6-2_11 miScript Primer Assay (cat# MS00033740), RT2 qPCR Primer Assay for Human MMP1 (cat# PPH00120B-200), and RT2 qPCR Primer Assay for Human GAPDH (Cat# PPH72843A).
4
Quantitative Analysis of nc886 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Qiagen™ miRNAeasy kit. Reverse transcription was performed using the Qiagen PCR miScript II System. Quantitative real time PCR (qPCR) was performed with the miScript SYBR Green PCR Kit using specific oligonucleotides. For nc886: 5′CGGGTCGGAGTTAGCTCAAGCGG3′ forward primer and 5′AAGGGTCAGTAAGCACCCGCG3′ reverse primer, as in Lee K et al. [12 (link)]. U6 RNA was amplified using the primer assay purchased from Qiagen (Hs_RNU6-2_11 miScript Primer Assay (MS00033740)) and the miScript Universal Primer (Qiagen). The relative quantification was attained using the ΔΔCT method, in a Rotor-Gene 6000 equipment (Corbett Life Science), employing U6 as the internal control of RNA load.
5
Quantification of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using RNeasy Plus Mini Kit or miRNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed with a First-Strand cDNA Synthesis Kit (Promega). cDNA for miRNA detection was generated by the miScript II RT Kit (Qiagen). RT reverse transcription quantitative PCR was performed with SYBR Green PCR Master Mix (Thermo Fisher Scientific) using the 7500Fast Real-Time PCR system (Thermo Fisher Scientific) and miScript SYBR Green PCR Kit with miScript Primer Assays to detect miRNA expression. The primer sequences were as follows: SCN5A (F 5′-TGGTTGTCATCCTCTCCATCGT-3′, R 5′-ATGAGGGCAAAGAGCAGCGT-3′), and GAPDH (F 5′-GAAGGTGAAGGTCGGAGTCAAC-3′, R 5′-CAGAGTTAAAAGCAGCCCTGGT-3′). Hs_miR-448_1 miScript Primer Assay (5′UUGCAUAUGUAGGAUGUCCCAU; Qiagen) was used for detecting miR-448, and the Hs_RNU6-2_11 miScript Primer Assay (Qiagen) was used as an endogenous control. The relative fold change was calculated by the 2–ΔΔCt method, and the measurements were normalized with respect to the endogenous control (RNU6, GAPDH).
6
Quantifying mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the Norgen Total RNA Purification Plus Kit (Geneflow, P4-0016) according to the manufacturer’s instructions. cDNA was synthesized to allow miRNA and mRNA detection using the miScript II RT Kit (QIAGEN, 218161). mRNA was detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) using SYBR TB Green Premix Ex Taq (Takara, RR820W) and primers supplied by Eurofins Genomics (Table 2 ). UBC (human) or Rpl13a (mouse) were used to normalize mRNA measurements via 2−ΔΔCt method.
miRNAs were detected by RT-qPCR using miScript SYBR Green (QIAGEN, 218075) and Hs_miR-147b_1 or Mm_miR-147_2 miScript Primer Assays (QIAGEN). Hs_RNU6-2_11 miScript Primer Assay (QIAGEN) was used to normalize miRNA measurements via 2−ΔΔCt method.
miRNAs were detected by RT-qPCR using miScript SYBR Green (QIAGEN, 218075) and Hs_miR-147b_1 or Mm_miR-147_2 miScript Primer Assays (QIAGEN). Hs_RNU6-2_11 miScript Primer Assay (QIAGEN) was used to normalize miRNA measurements via 2−ΔΔCt method.
7
Quantifying Endogenous miR-143 and miR-145
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Endogenous levels of miR-143 and miR-145 in the cancer cells were quantified relative to the non-cancerous lung cell line NL20 (ATCC® CRL-2503™), and normalized to the stably expressed reference snRNA RNU6 using real-time PCR and the miScript SYBR® Green PCR Kit (catalog# 218073, Qiagen, Hilden, Germany). Primers were miScript Primer Assays Hs_miR-143_1 miScript Primer Assay (catalog# MS00003514, Qiagen, Hilden, Germany), Hs_miR-145_1 miScript Primer Assay (catalog# MS00003528, Qiagen, Hilden, Germany) and Hs_RNU6-2_11 miScript Primer Assay (catalog# MS00033740, Qiagen, Hilden, Germany), according to the manufacturers protocol. In short, a total volume of 25 µl/well in a 96-well plate included 1 µl cDNA mixed with 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix, 2.5 µl 10x miScript Universal Primer, 2.5 µl 10x miScript Primer Assay, and 6.5 µl RNase-free Water. The plate was sealed and centrifuged for 1 minute at 1000 G before it was placed in the 7300 Real-Time PCR System (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Each sample was analyzed in quadruplicates, and two independent experiments were performed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!