To screen for loss of the target gene in KO cell lines, genomic DNA was isolated 10–14 days post transfection with the DNeasy Blood & Tissue Kit (Qiagen). One hundred nanograms of isolated DNA was mixed with 0.2 mM dNTPs, 2 µM forward primer and reverse primer, 1 unit HiFi Polymerase (Roche) and 1× HiFi reaction buffer supplemented with MgCl2 (Roche), 20 µl total volume. PCR steps were 5 min at 94°C followed by 35 cycles of 30 s at 94°C, 5 s at 60°C, 50 s at 72°C followed by a final elongation step for 7 min at 72°C. Five microlitres of this reaction was run on a 2% agarose gel to check for the presence of the expected product. To test for the presence of the sgRNA template in cells, genomic DNA was isolated from established cell lines or from freshly transfected cultures and analysed by PCR as described above, except that PCR steps were 5 min at 94°C followed by 30 cycles of 20 s at 94°C, 10 s at 65°C, 15 s at 72°C followed by a final elongation step for 7 min at 72°C. Primer sequences are detailed in the electronic supplementary material, file S1.
Hifi polymerase
Manufactured by Roche
Sourced in United States
The HiFi polymerase is a DNA polymerase enzyme used in molecular biology applications. It is known for its high fidelity, accuracy, and ability to amplify long DNA sequences with high efficiency.
Automatically generated - may contain errors
Lab products found in correlation
Mgcl2, by Roche (2 mentions)
Tagmentation enzyme, by Illumina (2 mentions)
Bioanalyzer high sensitivity, by Agilent Technologies (2 mentions)
Tagmentation dna buffer, by Illumina (2 mentions)
Hiseq 4000, by Illumina (2 mentions)
Hiseq 2000, by Illumina (2 mentions)
Hiseq 2500, by Illumina (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Pexp1, by Thermo Fisher Scientific (1 mentions)
Bl21 de3, by Thermo Fisher Scientific (1 mentions)
H3k9me3, by Merck Group (1 mentions)
Bcl2fastq2, by Illumina (1 mentions)
Microplex library preparation kit, by Diagenode (1 mentions)
Nextseq 500 550 system, by Illumina (1 mentions)
Pure beads, by Roche (1 mentions)
Novaseq 6000, by Illumina (1 mentions)
Novaseq 6000 system, by Novogene (1 mentions)
Miseq system, by Illumina (1 mentions)
Zymoclean gel dna recovery kit, by Illumina (1 mentions)
17 protocols using hifi polymerase
1
Screening for Gene Knockout in Cell Lines
2
Cloning and Purification of C. difficile SrtB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A gene encoding C. difficile 630 open reading frame CD2718 (srtB) omitting amino acids 1–32 was synthesised by Entelechon GmBH and cloned into plasmid vector pEXP1 (Invitrogen) to generate pEXP-srtB such that the protein was fused with a C-terminal hexahistidine tag. Plasmid pEXP1-srtB-C226A, encoding a mutant of SrtB with a cysteine to alanine substitution at position 226, was generated by site directed mutagenesis. Briefly, the entire plasmid was amplified by polymerase chain reaction (PCR) using HiFi polymerase (Roche diagnostics) using the oligonucleotide primers (SrtBC226AF - GTTACGCTGTCTACTGCTACTTACGAATTCG, SrtBC226AR - CGAATTCGTAAGTAGCAGTAGACAGCGTAAC) at an annealing temperature of 65°C. The codon substitution was confirmed by sequencing of the srtB gene. A gene encoding C. difficile 630 CD0386 was cloned into pTAC-MAT1 such that the protein was fused with an N-terminal hexahistidine tag. E. coli Bl21DE3 (Invitrogen) transformed with pEXP1 SrtB, pEXP1 SrtB C226A or pTAC-MAT1 CD0386 were grown to an optical density of 0.6 in Terrific Broth. IPTG was added to a final concentration of 1 mM and growth continued at 16°C for a further 16 hrs. Cells were harvested by centrifugation for 30 mins at 3,500 g and resuspended 10% w/v in 25 mM HEPES pH7.5, 500 mM NaCl, 10 mM Imidazole.
3
Amplification of CRISPR sgRNA Templates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For amplification of sgRNA templates, 0.2 mM dNTPs, 2 µM each of primer G00 (sgRNA scaffold) and a gene-specific forward primer and 1 unit HiFi Polymerase (Roche) were mixed in 1× HiFi reaction buffer with MgCl2 (Roche), 20 µl total volume. PCR steps were 30 s at 98°C followed by 35 cycles of 10 s at 98°C, 30 s at 60°C, 15 s at 72°C. Two microlitres of this reaction was run on a 2% agarose gel to check for the presence of the expected product. The remainder was heat-sterilized at 94°C for 5 min and transfected without further purification. Primer sequences are detailed in the electronic supplementary material, file S1.
4
Chromatin Immunoprecipitation (ChIP) Protocol for Malaria Parasites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin from synchronous-rings-stage parasites of 3D7 clone G7 was prepared and 3*108 cells per ChIP used for the previously described protocol (Lopez-Rubio et al., 2013 (link)). Briefly, chromatin was crosslinked in 1% formaldehyde for 10 min (Sigma-Aldrich, #SZBD1830V), sheared to an average length of 300 bp using the BioRuptor Pico, and individual histone modifications were pulled down using 0.5 μg of antibody for H3K4me3 (Diagenode, cat # K2921004), H3K9me3 (Millipore, cat # 257833), and homemade rabbit polyclonal anti-PfHP1. 5 μl rabbit polyclonal anti-H4K31me1 and 15 μl anti-H4K31ac were used for each experiment. To generate Illumina-compatible sequencing libraries, the immunoprecipitated DNA and input was processed using the MicroPlex Library Preparation Kit (Diagenode C05010014) according to manufacturer’s instructions. The optimized library amplification step used KAPA Biosystems HIFI polymerase (KAPA Biosystems KK2101). Pooled, multiplexed libraries were sequenced on an Illumina NextSeq 500/550 system as a 150-nucleotide single-end run. The raw data were demultiplexed using bcl2fastq2 (Illumina) and converted to fastq format files for downstream analysis. Two biological replicates were analyzed for each antibody.
5
ATAC-seq for Myeloma Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATAC-seq was performed on 50,000 viable sorted myeloma cells similar to previously described43 (link),61 (link),62 (link). Briefly, cells were pelleted at 500 × g for 10 min at 4 °C and resuspend in ice-cold nuclei-lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL) and centrifuged at 500 × g for 30 min at 4 °C. Nuclei were resuspended in 22.5 μl of tagmentation DNA buffer (Illumina) with 2 μl tagmentation enzyme (Illumina) at 37 °C for 60 min. Proteins were digested with 2 μg of proteinase K at 40 °C for 60 min. Tagmented DNA was isolated with two rounds of negative (0.6×) and positive (1.2×) size selection with SPRI beads (PureBeads, Kapa Biosystems). ATAC-seq libraries were amplified 12 times with Hifi Polymerase (Kapa Biosystems) and quantitated by qPCR (Kapa Biosystems) and high sensitivity bioanalyzer (Agilent). Sequencing was performed on a NovaSeq 6000 (Illumina) using 150 bp paired-end at the New York Genome Center.
6
CRISPR Indel Efficiency Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers designed with Primer3Plus were used to amplify ~ 240 bp fragments surrounding the on-target sequences for Illumina paired-end 150 bp sequencing (Supplementary Table S2 ). PCR was conducted using KAPA HiFi polymerase with the following cycling conditions: 98 °C for 1 min, followed by 25 cycles of 98 °C for 5 s, 64 °C for 10 s, and 72 °C for 10 s. Barcoded PCR amplicons were pooled equimolarly and sequenced using Illumina’s NovaSeq6000 System (Novogene). Novogene performed library construction and raw data acquisition. The acquired data was merged using Flash [48 (link)], demultiplexed with Barcode-splitter (https://pypi.org/project/barcodesplitter/ ), and subsequently analyzed for indel efficiencies using CRISPResso2 [49 (link)].
7
Amplification and Sequencing of Bacterial 16S V4 Region
8
TSA-Seq Library Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each of the TSA-Seq experiment staining conditions, input and streptavidin-pulldown DNA were used to make sequencing libraries using the Kapa Hyper Prep kit (Kapa Biosystems). DNA was blunt ended, 3′-end A tailed, and ligated to indexed adaptors with 6-nt barcodes. PCR amplification selectively enriched for those fragments with adaptors on both ends. Amplification was performed for 8–16 cycles with HiFi polymerase (Kapa Biosystems). A Bioanalyzer DNA high-sensitivity chip (Agilent Technologies) was used to determine library fragment sizes. Library fragment concentrations were measured by quantitative PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories) before pooling and sequencing. Libraries were pooled at equimolar concentration and sequenced for 101 cycles on an Illumina HiSeq 2000, HiSeq 2500, or HiSeq 4000 using a HiSeq Sequencing-By-Synthesis kit, version 4. The raw BCL files were converted into demultiplexed compressed fastq files using the bcl2fastq v1.8.2 and later v2.17.1.14 conversion software (Illumina). 27–81 million 100-nt reads were obtained for each sample with average quality scores >30. Library preparation and sequencing were done by the High-Throughput Sequencing and Genotyping Unit of the Roy J. Carver Biotechnology Center at University of Illinois at Urbana-Champaign (UIUC).
9
Illumina RNA-Seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed a gene expression analysis on samples from 113 patients (Supplementary Data 7 ). We purified poly-A tailed RNA (mRNA) from total RNA using Illumina’s TruSeq RNA Sample Prep v2 kits. We then fragmented the mRNA using metal ion-catalysed hydrolysis and synthesised a random-primed cDNA library. The resulting double-strand cDNA was used as the input to a standard Illumina library prep, whereby ends were repaired to produce blunt ends by a combination of fill-in reactions and exonuclease activity. We performed A-tailing to allow samples to be pooled, by adding an ‘A' base to the blunt ends and ligation to Illumina Paired-end Sequencing adaptors containing unique index sequences. Due to better performance, the 10-cycle PCR amplification of libraries was carried out using KAPA Hifi Polymerase. A post-PCR Agilent Bioanalyzer was used to quantify samples, followed by sample pooling and size-selection of pools using the LabChip XT Caliper. The multiplexed libraries were sequenced on the Illumina HiSeq 2000 for cohort 1 and HiSeq 4000 for cohorts 2–4 (75 bp paired-ends). Sequenced data underwent initial analysis and quality control (QC) on reads as standard. The sequencing depth was similar across samples, with 90% of samples passing final QC (see below) having 87.2–129.2 million reads.
10
Cloning and Amplifying Alpha-SNAP-RAC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For initial amplification and subcloning of native α‐SNAP‐RAC, approximately 100 ng of CTAB‐extracted gDNA from PI 89772 (rhg1‐a) was PCR‐amplified for 35 cycles using HiFi polymerase (KAPA Biosystems, Wilmington, MA). Primer annealing was at ~70°C for 30 s and extension was at 72°C for 5 min. The resulting α‐SNAP‐RAC amplicon from PI 89772 was separated by agarose gel electrophoresis, gel extracted using a Zymoclean Large Fragment DNA Recovery Kit (Zymo Research) and TA overhang cloned into a pTopo xL vector using the Topo xL PCR Cloning Kit (Life Technologies Corp.), per manufacturer's recommendations. For PCR detection of α‐SNAP‐RAC junctions or WT exon distances, ~25 ng of CTAB‐extracted genomic DNA from each respective accession was amplified using GoTAQ Green (New England Biolabs) for 32 cycles, separated on a 0.8% agarose gel and visualized.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!