The expression of FKBP5 mRNA was detected by RT-qPCR assays. Total RNA was isolated from cells using TRIzol reagent (Invitrogen, Waltham, MA, USA) and used for first-strand cDNA synthesis, using a Reverse Transcription System (Roche, Indianapolis, IN, USA) following the manufacturer’s protocol. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. The primer sequences were: GAPDH, forward 5′-AACGGATTTGGTCGTATTGGG -3′ and reverse 5′-TCGCTCCTGGAAGATGGTGAT -3′; FKBP5, forward 5′-ATGAAGAAAGCCCCACAGC -3′ and reverse 5′-CCTCACCATTCCCCACTCT -3′.
Reverse transcription system
Manufactured by Roche
Sourced in United States, Switzerland
The Reverse Transcription System is a laboratory instrument used for the conversion of RNA into complementary DNA (cDNA). It is a crucial tool in various molecular biology applications, including gene expression analysis, diagnostic assays, and RNA-based research.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (28 mentions)
Power sybr green pcr master mix, by Roche (13 mentions)
Abi prism 7500, by Thermo Fisher Scientific (6 mentions)
Sybr green pcr master mix, by Roche (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Q5 detection system, by Thermo Fisher Scientific (3 mentions)
Applied biosystems 7900 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr master mix, by Roche (2 mentions)
Trizol method, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Real time quantitative pcr assays, by Bio-Rad (1 mentions)
Rnase free dnase treatment, by Promega (1 mentions)
Ab177477, by Abcam (1 mentions)
Ab184305, by Abcam (1 mentions)
Ab117809, by Abcam (1 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (1 mentions)
M6a antibody, by Abcam (1 mentions)
32 protocols using reverse transcription system
1
RT-qPCR Analysis of FKBP5 Expression
2
Expression Analysis of lncRNA PCAT1 in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of lncRNA PCAT1 in eight ADPC frozen samples, six CRPC frozen samples, LNCaP-AI and C4-2 cells transfected with shRNA and siRNAs were detected with RT-PCR. Total RNA was isolated from cells using Trizol reagent (Invitrogen) and used for the first strand cDNA synthesis with the Reverse Transcription System (Roche) following the manufacturer’s protocol. Resulting cDNA was then analyzed by PCR using Applied Biosystems 7900 Real Time PCR System (Thermo Scientific) and SYBR Green PCR Master Mix (Roche) according to the manufacturers’ instructions. GAPDH and β-actin were used as an internal control. The relative expression of RNAs was calculated using the comparative Ct method. Primer sequences are listed below: PCAT1, forward 5′-TGAGAAGAGAAATCTATTGGAACC-3′ and reverse 5′-GGTTTGTCTCCGCTGCTTTA-3′; GAPDH, forward 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse 5′-GGCTGTTGTCATACTTCTCATGG-3′; β-actin, forward 5′-GGGAAATCGTGCGTGACATTAAG-3′ and reverse 5′-TGTGTTGGCGTACAGGTCTTTG-3′. Separate primer sets used in mutant assays (Figure 4D and E ) are listed below: PCAT1, forward 5′-CGCAAAGGAACCTAACTGGAC-3′ and reverse 5′-TTCATTGCACATCACAATCCG-3′; PCAT1-MUT, forward 5′-TTCCCATGTGCCTCTAAGTGC-3′ and reverse 5′-CCCGTTATGTTGACCAATGCC-3′.
3
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated with TRIzol reagent (Invitrogen) and used for first-strand cDNA synthesis via the Reverse Transcription System (Roche). Quantitation of all gene transcripts was made by qRT-PCR using a Power SYBR Green PCR Master Mix (Roche) and Thermo Quant Studio 5 sequence detection system (Thermo) with the expression of ACTB (β-actin) as the internal control. The primers used are listed in Table S6 .
4
Osteogenic Differentiation of hASCs and hBMMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hASCs and hBMMSCs were seeded on different surfaces as described above, in 6-well plates. After 7 and 14 days of osteoinduction, the Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate the total cellular RNAs of each group. After synthesizing the first strand cDNA using the reverse transcription system (Roche, Basel, Switzerland), quantification of all gene transcripts was performed by real-time polymerase chain reaction (qPCR) using a Power SYBR Green PCR Master Mix and an ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA). The β-actin expression was used as the internal control. The primer sequences were shown in Table 1 . The cycle threshold values (Ct values) were used to calculate the fold differences among the samples, using the ∆∆Ct method65 (link),66 (link).
Primers for realtime PCR.
| Gene | Forward primers | Reverse primers |
|---|---|---|
| RUNX2 | ATGGGATGGGTGTCTCCACA | CCACGAAGGGGAACTTGTC |
| OSX | CCTCCTCAGCTCACCTTCTC | GTTGGGAGCCCAAATAGAAA |
| OCN | CACTCCTCGCCCTATTGGC | CCCTCCTGCTTGGACACAAAG |
| β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
5
Quantifying Cancer Metabolism Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were isolated with the TRIzol reagent (Invitrogen) and used for the first strand cDNA synthesis with the Reverse Transcription System (Roche). Quantitation of all gene transcripts was done by real time RT-PCR (qPCR) using Power SYBR Green PCR Master Mix and Roche LightCycler®480 II sequence detection system. The qPCR primers sequences were: HK2: GAGCCACCACTCACCCTACT (F), CCAGGCATTCGGCAATGTG (R); PKM2: ATGTCGAAGCCCCATAGTGAA (F), TGGGTGGTGAATCAATGTCCA (R); GLUT1: GGCCAAGAGTGTGCTAAAGAA (F), ACAGCGTTGATGCCAGACAG (R); GPI: CAAGGACCGCTTCAACCACTT (F), CCAGGATGGGTGTGTTTGACC (R); LDHA: ATGGCAACTCTAAAGGATCAGC (F), CCAACCCCAACAACTGTAATCT (R); PFKM: GGTGCCCGTGTCTTCTTTGT (F), AAGCATCATCGAAACGCTCTC (R); Galectin-3: ATGGCAGACAATTTTTCGCTCC (F), GCCTGTCCAGGATAAGCCC (R).
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were isolated by TRIzol reagent (Invitrogen) and transcribed by the Reverse Transcription System (Roche). Quantitation of all gene transcripts was done by qPCR using a Power SYBR Green PCR Master Mix (Roche) and Q5 detection system (Thermo) with the expression of ACTB as the internal control. The primers used were listed in Additional file 4 : Table S4.
7
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were extracted using TRIzol reagent (Thermo Fisher, cat. 15596026, MA, USA), followed by reverse transcription using the Reverse Transcription System (Roche, Basel, Switzerland) or miRNA First-Strand cDNA Synthesis Kit (Tiangen, cat. KR211, Beijing, China). RT-qPCR was performed using SYBR Green Master Mix reagents (Life Technologies, CA, USA). Primers were listed in Supplementary Table 2 .
8
Osteogenic Differentiation Regulation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded in 6-well plates and divided into four groups as above. All layers were harvested on 7 and 14 days after osteogenic induction. Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and used for first strand cDNA synthesis using the Reverse Transcription System (Roche, Basel, Switzerland). Real-time quantitative PCR assays were performed according to manufacturer's instructions (Bio-Rad, Hercules CA, USA). Expression of β-actin was used as an internal control. Primers used were as follows:
RUNX2,5'-ATGGGATGGGTGTCTCCACA-3' (forward), 5'-CCACGAAGGGGAACTTGTC-3' (reverse).
OC,5'-CACTCCTCGCCCTATTGGC-3' (forward), 5'-CCCTCCTGCTTGGACACAAAG-3' (reverse).
β-actin,5'-CATGTACGTTGCTATCCAGGC-3' (forward), 5'-CTCCTTAATGTCACGCACGAT-3' (reverse).
RUNX2,
OC,
β-actin,
9
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were isolated from samples with the Trizol reagent (Invitrogen). First strand cDNA synthesis with the Reverse Transcription System (Roche). Quantitation of all gene transcripts was done by qPCR using Power SYBR Green PCR Master Mix and an ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, CA) with the expression of GAPDH as the internal control. The primer pairs used were: USP11, 5′-GAGAACGGACGGCGATGG-3′ (forward) and 5′-CACAAGGAACCAGCTTTCGC-3′ (reverse); MTA2, 5′-GGAGTGGCCTTCGGAACC-3′ (forward) and 5′-ACGTAATCTTTTCGAATCGAGGC-3′ (reverse); HDAC2, 5′-ACTATCGCCCCCACGTTTC-3′ (forward) and 5′-AATATCACCGTCGTAGTAGTAGCAG-3′ (reverse).
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from samples with Trizol reagents (Invitrogen) and used for the first strand cDNA synthesis with the Reverse Transcription System (Roche). Any potential DNA contamination was removed by RNase-free DNase treatment (Promega). Relative quantitation was determined using the ABI PRISM 7500 sequence detection system (Applied Biosystems) that measures real-time SYBR green fluorescence and then calculated by means of the comparative Ct method (2−ΔΔCt) with the expression of GAPDH as an internal control. The sequences of the primers used are provided in Supplementary Table 4 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!