mTOR complex components, Myc-mTOR (Addgene, 1861), HA-Raptor (Addgene, 8513), and Flag-Rheb (Addgene, 19996), were transfected individually into HEK293 cells grown in 100 mm dishes (2 × 106 cells), and each component was purified from cell lysates using Myc, HA, and Flag antibodies. GST-JMJD1C purified after expressing it in E. coli was incubated with mTOR complex (1:1:1 ratio of total 300 ng in 15 μL) in the kinase buffer containing 50 mM HEPES, pH 7.4, 10 mM MgCl2, 10 mM MnCl2, 1 mM DTT with or without 500 μM ATP at 25 °C for 1 h and the reaction was terminated by adding 20 μL 2 × SDS sample buffer. Phosphorylation reaction mixture containing 0.5 μg of protein was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and JMJD1C phosphorylation was detected with pan-phospho-serine and pan-phospho-threonine antibodies or phospho-specific anti-peptide antibody that we have raised as indicated above.
Myc mtor
Manufactured by Addgene
Sourced in United States
Myc-mTOR is a protein kinase complex that plays a critical role in the regulation of cell growth, proliferation, and metabolism. This complex is composed of the mammalian target of rapamycin (mTOR) protein and the Myc oncoprotein. The Myc-mTOR complex is involved in the integration of various cellular signals, including nutrient availability, growth factor signaling, and energy status, to coordinate the appropriate cellular response.
Automatically generated - may contain errors
Lab products found in correlation
Ha raptor, by Addgene (3 mentions)
Dharmafect 1 transfection reagent, by GE Healthcare (1 mentions)
In fusion kit, by Takara Bio (1 mentions)
Prk5 ha gst raga 66l, by Addgene (1 mentions)
Prk5 ha gst ragc 75l, by Addgene (1 mentions)
Trpml1 ha, by Addgene (1 mentions)
Pcdna3 flag rheb n153t, by Addgene (1 mentions)
Egfp rab7a q67l, by Addgene (1 mentions)
Ccsb broad lentiviral expression library, by Horizon Discovery (1 mentions)
Pfuultra 2 fusion hs dna polymerase, by Agilent Technologies (1 mentions)
6 protocols using myc mtor
1
Phosphorylation of JMJD1C by mTOR Complex
2
Expression and Mutagenesis of DAPK2, mTOR, and ULK1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FLAG- or HA-tagged DAPK2 and FLAG-tagged DAPK2 K42A10 (link) were expressed from pcDNA3 expression vectors. myc-mTOR, myc-mTOR D2357E/V2364I, myc-Raptor and HA-raptor (all in pRK5 vector) were purchased from Addgene (Cambridge, MA, USA). FLAG-ULK1 was generated by removing the GFP from mULK1-GFP (kindly provided by N Mizushima) and inserting the FLAG-tag at the N terminus. The GFP-LC3 plasmid, pEGFPC1-LC3, was a kind gift from N Mizushima and T Yoshimori. Control plasmid consisted of empty pcDNA3 plasmid. Ser to Ala mutation was generated by PCR-mediated site-directed mutagenesis. All cell lines were transfected by standard calcium phosphate technique.
3
Transfection of Rat INS-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat insulinoma (INS-1) cells were provided by C. Newgard (Duke University, Durham, NC) and grown as previously described (Oslowski et al., 2012 (link)). INS-1 cells were transfected with 10 nM siRNA using DharmaFECT1 transfection reagent (GE Healthcare). The sense and antisense sequences of siRNAs were as follows: nonsilencing, 5′-UUCUCCGAACGUGUCACGUUU-3′ and 5′-ACGUGACACGUUCGGAGAAUU-3′; mTOR, 5′-GGCCUAUGGUCGAGAUUUAUU-3′ and 5′-UAAAUCUCGACCAUAGGCCUU-3′; ChREBP #1, 5′-AAGAGGCGUUUCAAUAUUAUU-3′ and 5′-UAAUAUUGAAACGCCUCUUUU-3′; and ChREBP #2, 5′-GCAACUGAGGGAUGAAAUAUU-3′ and 5′-UAUUUCAUCCCUCAGUUGCUU-3′. siRNAs against raptor or rictor were purchased from Santa Cruz Biotechnology, Inc. For overexpressing of mTOR, INS-1 cells were transfected with indicated pRK5-based expression vectors: myc-mTOR (Addgene) and myc-mTOR kinase dead (myc-mTOR KD; Addgene). The total amount of plasmid DNA in each transfection was normalized with empty pRK5.
4
Generation of Recombinant Protein Expression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myc-mTOR (Addgene plasmid # 1861), pRK5-HA GST RagA 66L (Addgene plasmid # 19300), pRK5-HA GST RagC 75L (Addgene plasmid # 19305) and HA GST PreScission p70 S6K1 (Addgene plasmid # 15511) were gifts from David Sabatini. pcDNA3-FLAG-Rheb-N153T (Addgene plasmid # 19997) was a gift from Fuyuhiko Tamanoi. pcDNA-CaM was a gift from David Yue. TRPML1-HA (Addgene plasmid # 18825) was a gift from Craig Montell. EGFP-Rab7A Q67L (Addgene plasmid # 28049) and EGFP-Rab7A T22N (Addgene plasmid # 28048) were gifts from Qing Zhong.
FLAG-tagged RhebN153T was amplified by PCR and cloned into the EcoRI site of pLVX-AcGFP-N1 vector. GST-tagged 4EBP1 was amplified by PCR and cloned into a pDEST15-based vector. FLAG-tagged CaM was amplified by PCR and cloned into a pGEX6-based vector. TRPML1 was amplified by PCR and cloned into a pEGFP-based vector. All ligations were performed with Infusion Kit (Clontech Laboratories, Inc.) according to the manufacture’s instruction. After sequence verification, these plasmids were used, as described below, in transient cDNA transfections, bacterial protein expression or to produce the lentiviruses needed to generate cell lines stably expressing the proteins.
FLAG-tagged RhebN153T was amplified by PCR and cloned into the EcoRI site of pLVX-AcGFP-N1 vector. GST-tagged 4EBP1 was amplified by PCR and cloned into a pDEST15-based vector. FLAG-tagged CaM was amplified by PCR and cloned into a pGEX6-based vector. TRPML1 was amplified by PCR and cloned into a pEGFP-based vector. All ligations were performed with Infusion Kit (Clontech Laboratories, Inc.) according to the manufacture’s instruction. After sequence verification, these plasmids were used, as described below, in transient cDNA transfections, bacterial protein expression or to produce the lentiviruses needed to generate cell lines stably expressing the proteins.
5
Construction and Characterization of Epitope-Tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HA-tagged TJP1 was amplified from pEGFP-C1 ZO1 (Addgene, 30313) and cloned into pcDNA3 vector containing a HA tag. Site-directed mutagenesis was performed using a PCR-based strategy with PfuUltra II Fusion HS DNA polymerase (Agilent). FLAG-PER1 and FLAG-CRY1 were kindly provided by Dr. Erquan Eric Zhang (National Institute of Biological Sciences, Beijing). HA-S6K was previously described31 (link). FLAG-PER1 (1-1147) was amplified from FLAG-PER1 and cloned into p3 × FLAG-CMV-7.1 vector. V5-tagged BMAL1 and CLOCK were from CCSB-Broad Lentiviral Expression Library (GE Dharmacon). FLAG-tagged mTOR was amplified from myc-mTOR (Addgene, 1861) and cloned into p3 × FLAG-CMV-7.1 vector. All adenoviruses were generated using the pAdTrack/pAdEasy or pShuttle/pAdEasy system and amplified in HEK293 cells. Adenoviruses were purified by CsCl gradient centrifugation and dialyzed in 1 × PBS with 15% glycerol. GFP adenovirus has been described previously31 (link). All expressed constructs used in this study were confirmed by sequencing.
6
Engineered S6K1, ULK1, and eIF4E Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pMT2-based cDNA encoding an amino-terminal HA-tagged S6K1 (αI variant,) was a kindly gifted by Prof.
Joseph Avruch, Harvard Medical School Boston, USA. S6K1 point mutant S6K1412E, were described previously [18] . cDNA clones of HA-ULK1 (plasmid#31963), HA-eIF4E (plasmid#17343), HA-Raptor (#8513), myc-kinase dead mTOR (#8482), myc-mTOR (#1861), and myc-PRAS40 (#15476) were purchased from addgene. HA tagged ULK1 truncation mutant ULK1∆401-407 was generated using primers (1) 5'Phos-TGCAGCAGCTCCCCCAGTCCCTCAGGCCGG and (2) 5'Phos-CCGGCCGTGGCTCTCCAAGCCCGCAGAGGC. HA-tagged eIF4E, previously sub-cloned in pKMYC vector backbone [17] (link), was used as template to generate its truncation variant, eIF4E∆9-15. Following primers were used for the purpose (1) 5'Phos-ACTACAGAAGAGGAGAAAACGGAATC and (2) 5'Phos-GGTTTCCGGTTCGACAGTCGCCAT. Phospho deficient mutant of eIF4E, S209A was constructed using primers (1) 5GCTACTAAGAGCGGCGCCACCACTAA (2) 5 TATTTTTAGTGGTGGCGCCGCTCTTAG while as its phosphomimitic variant, S209E was constructed using primers (1) 5'
Joseph Avruch, Harvard Medical School Boston, USA. S6K1 point mutant S6K1412E, were described previously [18] . cDNA clones of HA-ULK1 (plasmid#31963), HA-eIF4E (plasmid#17343), HA-Raptor (#8513), myc-kinase dead mTOR (#8482), myc-mTOR (#1861), and myc-PRAS40 (#15476) were purchased from addgene. HA tagged ULK1 truncation mutant ULK1∆401-407 was generated using primers (1) 5'Phos-TGCAGCAGCTCCCCCAGTCCCTCAGGCCGG and (2) 5'Phos-CCGGCCGTGGCTCTCCAAGCCCGCAGAGGC. HA-tagged eIF4E, previously sub-cloned in pKMYC vector backbone [17] (link), was used as template to generate its truncation variant, eIF4E∆9-15. Following primers were used for the purpose (1) 5'Phos-ACTACAGAAGAGGAGAAAACGGAATC and (2) 5'Phos-GGTTTCCGGTTCGACAGTCGCCAT. Phospho deficient mutant of eIF4E, S209A was constructed using primers (1) 5GCTACTAAGAGCGGCGCCACCACTAA (2) 5 TATTTTTAGTGGTGGCGCCGCTCTTAG while as its phosphomimitic variant, S209E was constructed using primers (1) 5'
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!