Wild-type (CD45.1+) and T-bet-/- mice were immunized subcutaneously, over the flanks, with 100 μg of an immunodominant myelin oligodendrocyte glycoprotein peptide (MOG35-55; Biosynthesis, Lewisville, Texas) emulsified in complete Freund's adjuvant (CFA; Difco, Detroit MI). 10-14 days later, draining lymph node cells were harvested, passed through a 70-mm cell strainer (BD Falcon) and cultured with MOG35-55 (50 μg/ml) in the presence of recombinant IL-23 (8 ng/ml; R&D Systems, Minneapolis, MN), recombinant mouse IL-1α (10 ng/ml; PeproTech, Rocky Hill, NJ), and anti-IFN-γ (clone A11B11). 2 × 106 CD4+ T cells from each donor pool were injected, either separately or in combination, per mouse by the intraperitoneal route. The recipients were observed daily for signs of EAE as described previously (Carlson et al., 2008 (link)).
Recombinant il 23
Manufactured by R&D Systems
Recombinant IL-23 is a cytokine that is produced using recombinant DNA technology. It is a heterodimeric protein composed of the subunits p19 and p40. Recombinant IL-23 can be used in various research applications.
Automatically generated - may contain errors
Lab products found in correlation
Pam3csk, by Merck Group (2 mentions)
β mercaptoethanol, by Merck Group (2 mentions)
Mog35 55, by R&D Systems (1 mentions)
70 mm cell strainer, by BD (1 mentions)
Recombinant mouse il 1α, by Thermo Fisher Scientific (1 mentions)
Mog35 55, by Bio-Synthesis (1 mentions)
Ready set go elisa kit, by Thermo Fisher Scientific (1 mentions)
Naive cd4 t cell isolation kit 2, by Miltenyi Biotec (1 mentions)
Ova323 339 peptide, by AnaSpec (1 mentions)
Human il 17a elisa kit, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Golgiplug, by BD (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
Carboxyfluorescein succinimidyl ester (cfse), by Merck Group (1 mentions)
Cdahfd, by Research Diets (1 mentions)
Recombinant murine il 23, by R&D Systems (1 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Dnase 1 amplification grade, by Thermo Fisher Scientific (1 mentions)
Quantstudio real time pcr software version 1, by Thermo Fisher Scientific (1 mentions)
12 protocols using recombinant il 23
1
Adoptive Transfer of T-bet Knockout T Cells for EAE
2
Priming of CD11c+ DCs and T cell Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD11c+ DCs of mouse skin and skin DLN (axillary and inguinal) were purified as described previously (Oyoshi et al., 2010 (link)). DCs were primed with SCM or recombinant IL-23 (20 ng/ml; R&D Systems) for 24 h. After extensive washing, DCs were co-cultured with naive CD4+CD62L+ T cells isolated by using naive CD4 T cell isolation kit II (Miltenyi Biotec) in the presence of OVA323–339 peptide (4 µM; AnaSpec Inc.) for 4–5 d. In some experiments, neutralizing antibody goat anti–mouse IL-23 (He et al., 2007 (link)) was used at 10 µg/ml. For in vivo DC priming experiment, OVA (1 mg in 100 µl saline) or saline was epicutaneously applied to shaved, tape-stripped skin of WT, Tlr4−/−, and Il23r−/− mice. 24 h after sensitization, DCs were isolated from axillary and inguinal LNs and naive CD4+ T cells were purified from spleen of OT-II mice. DLN CD11c+ cells (105) were co-cultured in duplicates with OT-II CD4+ T cells (105) without addition of exogenous OVA protein for 5 d. Cell-free supernatant was used to detect mouse IL-22, IL-17, IL-13, and IFN-γ with ELISA Ready SET Go kits (eBioscience) with sensitivity of 8, 4, 4, and 15 pg/ml, respectively.
3
IL-17A Production Assay from Dermal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
0.2 × 105 cells/100 μl dermal from HD or leprosy patients were incubated in RPMI-1640 (Invitrogen), 2 mg/ml recombinant IL-23 (R&D system, Minneapolis, MN), 1 mg/ml Pam3CSK (Merck, Rahway, NJ), 100 ng/ml LPS (Merck) or 50 mg/ml Curdlan (Merck) was added at a concentration of 2 mg/ml for 24h, the supernatant was harvest for IL-17A measurement by IL-17A Human ELISA kit (Thermo Fisher Scientific, Waltham, MA) according to manufacturer’s instructions, then stimulated with presence of GolgiPlug (BD Bioscience) for 4h.
4
Dermal Cells Proliferation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dermal cells suspensions were labeled with CFSE (Sigma-Aldrich) and then stimulated with 1 mg/ml of Pam3CSK (Merck) or 2 of mg/ml recombinant IL-23 (R&D system) for 4 days. Cells were harvested and stained with CD3 and TCRγδ. Proliferation was measured by expression of CFSE (Sigma-Aldrich).
5
Dietary Modulation of Hepatic IL-23 Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal experiments were performed after approval from the Institutional Animal Care and Use Committee (IACUC) of Genentech. Il23r-/- mice were generated as described previously [24 (link)], the control group was littermate wild type (WT) mice. Diet used in this study was purchased from Research Diets; normal diet (ND) was compared either to Western Diet (WD) (cat#D19021501) composed of 40% kcal fat, 22% kcal fructose, and 1.25% cholesterol or choline deficient L-amino acid derived high fat diet (CDA-HFD) (cat#A06071302) composed of 60% kcal fat, 0.1% methionine, and no added choline. All mice were fed with diet starting at 8 weeks of age, and all mice used were males. The ND and WD cohorts were challenged with diet for 20 weeks. The ND and CDA-HFD cohorts were challenged with diets for 9 weeks. C57BL/6J mice from Jackson Laboratory were used for intraperitoneal injection (IP) with PBS or recombinant IL-23. Recombinant murine IL-23 was purchase from R&D. Mice were injected with either PBS or 0.5ug recombinant IL-23 for three consecutive days and livers were harvested 24hrs after last injection.
6
Splenic Cell RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Splenic cell suspensions were prepared as described above. 1×105 cells were cultured in Iscove's modified Dulbecco's medium supplemented with 10% fetal calf serum (Gibco), 2 mM l ‐glutamine, 100 U/mL penicillin/streptomycin (Lonza) and 50 µM β‐mercaptoethanol (Sigma‐Aldrich) for 3 days. Cells were cultured in U‐bottom 96‐well plates and left untreated or treated with 50 ng/mL recombinant IL‐23 (R&D Systems). RNA was isolated using the GenElute Mammalian Total RNA Miniprep Kit according to manufacturer's instructions (Sigma Aldrich). RNA was treated with 0.1 U/µL DNAse I Amplification Grade (Invitrogen). cDNA was synthesized using random hexamer primers and 10 U/µL Superscript II (Invitrogen). Primers were designed with ProbeFinder software (Roche Applied Sciences, USA) and probes were used from the Universal Probe Library (Roche Applied Science, USA). 18srRNA (forward primer 5′‐GCAATTATTCCCCATGAACG‐3′; reverse primer 5′‐ GGGACTTAATCAACGCAAGC‐3′; probe 48) was used to normalize gene expression. For CCR7, forward primer 5′‐ CAGGGAAACCCAGGAAAAAC‐3′ and reverse primer 5′‐ATCTTGGCAGAAGCACACCT‐3′ with probe 77 were used. Real‐time PCR was performed using the Viia7 system and data were analyzed using QuantStudio Real‐time PCR software version 1.3 (Applied Biosystems, USA).
7
Murine CD4+ T cell Polarization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine CD4+CD62L+ (naive) T helper cells were isolated as previously described 15 and cultured at a concentration of 2.5 × 106 cells/5 ml in 6‐well plates in RPMI medium supplemented with 10% fetal calf serum (Merck), 300 μg/ml glutamine (Invitrogen), 100 units/ml penicillin, 100 μg/ml streptomycin (Life Technologies), and 50 μM β‐mercaptoethanol (Sigma‐Aldrich) at 37°C in 5% CO2 and 4.2% oxygen. The T helper cells were stimulated polyclonally with plate‐bound anti‐CD3 antibody (145‐2C11; 3 μg/ml) and soluble anti‐CD28 antibody (37.51; 1.5 μg/ml). For Th1 polarization, 5 ng/ml recombinant IL‐12, 10 ng/ml recombinant IL‐2, and 10 μg/ml anti–IL‐4 antibody (11B11) was added. To induce Th17 polarization, 10 μg/ml anti‐IFNγ (AN18.17.24), 10 μg/ml anti–IL‐4 (11B11), 20 ng/ml recombinant IL‐6, 20 ng/ml recombinant IL‐23, and 1 ng/ml recombinant transforming growth factor β (all from R&D Systems) were added. After 48 hours of stimulation, the cells were removed from the antibody‐coated culture dishes and cultured for an additional 3–4 days. T cell receptor–transgenic OT‐II lymphocytes were activated with 1 μg/ml of ovalbumin 327–339 peptide in the presence of irradiated (30 Gy) CD90‐depleted splenocytes from C57BL/6 mice. For repeated activation, viable T helper cells were isolated using Ficoll density‐gradient centrifugation and stimulated again under the original conditions.
8
Prostate Cancer Cell Modulation by MDSC Signals
9
Isolation and Priming of Dendritic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal human skin samples were obtained as the discarded products of dermatologic surgery. Subcutaneous fat was removed, and remaining tissue was washed with PBS. The dermal layer was scratched as described above and incubated with Dispase II (1 mg/ml; Gibco) overnight at 37°C. Epidermis and dermis were separated with forceps. Epidermal sheets were chopped with scissors and incubated with Liberase (0.3 mg/ml; Roche) at 37°C for 1.5 h LCs were isolated from epidermal cell suspension by using a CD1a isolation kit (Miltenyi Biotec). Blood DCs were isolated by using Blood Dendritic Cell Isolation kit II (Miltenyi Biotec). DCs were primed with recombinant IL-23 (100 ng/ml; R&D Systems) for 24 h. After extensive washing, DCs were co-cultured with allogeneic naive CD4 T cells (Miltenyi Biotec) in the presence of anti-CD3/CD28 beads (Miltenyi Biotec) for 5 d. Cell-free supernatants were used to detect IL-22, IL-17A, IL-13, and IFN-γ by ELISA kit (eBioscience).
10
Intracellular Cytokine Staining Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For IL-22 staining, LPLs were stimulated with 40ng/ml of recombinant IL-23 (R&D Systems) for 3 hr together with Golgi Stop (BD Biosciences). For IL-5, IL-17F and IL-17A staining, LPLs were stimulated with 100ng/ml phorbol-12-myristate 13-acetate (PMA) and 1 μg/ml Ionomycin for 3 hr in the presence of Golgi Stop at 37C, 5% CO2. Alternatively, single cell suspensions from mesenteric lymph nodes, small intestine and colon were stimulated with 20ng/ml IL-1β, 20ng/ml IL-23 and a commercially available cell stimulation cocktail (ebioscience) containing PMA, Ionomycin, Brefeldin A and Monensin in the absence (DMSO) or presence of 10nM 7α,25-OHC (Avanti Polar Lipids) for 4 hr. After stimulation, cells were first surface-stained and subsequently incubated with Fixation/Permeabilization buffer (Foxp3 Transcription Factor Staining Buffer Kit, eBioscience) at 4°C for 30 min. For intracellular transcription factor and cytokine staining after fixation, cells were incubated for 20 min at room temperature with fluorochrome-conjugated Abs (see Key Resources Table ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!