Escherichia coli bl21 de3 cells

The Agp2-PCM gene (NCBI Gen-Bank ID AAK87910) was PCR-amplified from A. fabrum genomic DNA and cloned into a pET21b expression vector with C-terminal His-tag using the following primers: forward primer sequence ATGTATATCTCCTTCTTAAAGTTAAAC and reverse primer sequence CATCACCATCACCATCACTAAGATCCG. The gene encoding the photosensor core module (PCM) derived from Agp2 (1–501 amino acids plus hexa-histidine tag) was transformed into Escherichia coli BL21-DE3 cells (Agilent Technologies)^{6 (link),23 (link)}.

The genes encoding xylanase, StXyl10 (DNA Data Bank of Japan AN: LC603131) and StXyl11 (AN: LC603130), were amplified by polymerase chain reaction (PCR) using the genomic DNA of S. thermogriseus as a template and the following sets of primers: 5′- ACATATGGCCGAGAGCACACTCGGCGC-3′ (StXyl10-forward) and 5′- TAAGCTTTCAGGTGCGGATCCAGCGCT-3′ (StXyl10-reverse); and 5′-ACATATGGACACCTACGTCGACACGAACCA-3′ (StXyl11-forward) and 5′-TAAGCTTTCAGCTCGTACTGCAGGAGACCG-3′ (StXyl11-reverse), where underlines indicate the restriction enzyme sites. Then, the genes were cloned into the NdeI-HindIII site of pET28a to construct expression vectors of pET28a(StXyl10) and pET28a(StXyl11). The recombinant proteins were expressed in Escherichia coli BL21 (DE3) cells (Agilent Technologies, Palo Alto, CA, USA) harboring each expression vector and purified as previously described (Kumagai et al. 2011 (link)). The purity of the proteins was confirmed by SDS-PAGE. The protein concentrations were determined by their absorbance at 280 nm using their respective molar extinction coefficients.

Expression of N-terminally His-tagged apoA-I was carried out by following previously published methods (80 (link), 81 (link)). A pNFXex expression vector coding for human apoA-I with an N-terminal His tag (kindly provided by Dr. M. Oda, Oakland Research Institute) was transformed into Escherichia coli BL21 (DE3) cells (Agilent Technologies) and grown at 37 °C in LB media containing 100 μg/ml ampicillin (Melford Laboratories). The plasmid construct expresses apoA-I with an E2D mutation enabling removal of the His tag by cleavage of the acid-labile Asp-2–Pro-3 peptide bond with formic acid, leaving the native residues 3–243. The remaining expression and purification methods are described in Ref. 12 (link).
ApoA-I fibrils were formed from up to 36 μm apoA-I incubated in McIlvaine buffer (165 mm Na₂HPO₄, 17.6 mm citrate, pH 4), typically for 3 days (unless specified otherwise), alone or in the presence of a 2-fold molar excess of heparin (IdoU(2S)-GlcNS(6S) 14–15 kDa, >70%, Iduron). Expression of MAβ40 and fibril formation by seeding with the 3-fold symmetrical (3Q) morphology was carried out as described previously (45 (link)).

Full-length wild-type SV40 VP1 and its derivative mutants were constructed with the pGEX-4T2 plasmid (GE Healthcare, Piscataway, NJ), expressed in Escherichia coli BL21(DE3) cells (Agilent) and purified by using glutathione S-transferase (GST) affinity purification and thrombin cleavage, as previously described (21 (link)). Mutant VP1 unable to form VLPs was truncated after amino acid position 305 (21 (link)).
For electron microscopy, purified pentamers were diluted in pH 7.2 PBS at 20 µg/ml and analyzed after negative staining with 1% uranyl acetate (21 (link)) via Tecnai T12 transmission electron microscopy at the Yale Electron Microscopy Core Facility. For transmission electron microscopy of infected cells, 2 × 10⁶ CV-1 cells were mock infected or infected with wild-type or A70L SV40 at an MOI of 1.5. At 64 h postinfection, samples were fixed, stained with 2% uranyl acetate, dehydrated, embedded, sectioned, and mounted onto copper grids as described elsewhere (40 (link)).
Purified pentamers were added to CV-1 cells maintained in DMEM containing 1% (vol/vol) FBS.

MITF DNA-binding domains (residues 180-296) that were either WT, K243Q or K243R were expressed in Escherichia coli BL21(DE3) cells (Agilent Technologies). Cultures were grown in Luria-Bertani broth to an OD₆₀₀ of 0.7-0.8. Recombinant protein overexpression was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG; 0.5 mM final concentration) and the cultures were incubated for a further 6 h. Cells were harvested by centrifugation, washed in PBS and frozen on dry ice. After thawing, cells were suspended in lysis buffer (50 mM NaH₂PO₄, 300 mM NaCl, 10 mM imidazole, 10% v/v glycerol, pH 7.4 [NaOH], 20 mg/ml lysozyme [Invitrogen], 1 × protease inhibitor cocktail [Roche]). Cells were lysed by sonication and centrifuged. Clarified lysate was mixed by rotation with a 50% Ni-NTA slurry (QIAGEN) previously equilibrated in lysis buffer and loaded in gravity flow columns (Bio-Rad). After extensive washing in wash buffer (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, 10% v/v glycerol, pH 7.4 [NaOH]), bound material was serially eluted in elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, 10% v/v glycerol, pH 7.4 [NaOH]). Fractions were analyzed by SDS-PAGE and Coomassie staining to determine purity, and pure fractions were pooled and glycerol added to a final concentration of 30% v/v.