Several reporter plasmids were constructed containing the putative target sequence for miR-137 identified in the Cacna1g, Glrb, Synpo, Huwe-1 and Adcyap1r1 3′UTR. For Glrb, we also constructed a reporter plasmid with a mutant form of the target site. Neuro2A cells were infected with a lenti-GFP mmu-miR-137-3p miRNA virus (Lenti-III-mico-GFP vector, viral titer > 107 IU/ml, miRNA ID: MIMAT0000149; Applied Biological Materials; abm, Vancouver, Canada) 48 hours before transfection with the reporter plasmids in the presence or absence of 80nM miR-137 inhibitor (Anti-miR miRNA Inhibitor, Thermofisher Scientific). The cells were collected and lysed 48 hours later and luciferase activity was detected using a Dual-LuciferaseR Reporter Assay System kit (E1910, Promega Corporation, Madison, WI, USA). The ratio of firefly luciferase to renilla luciferase was regarded as relative luciferase activity.
Anti mir mirna inhibitor
Manufactured by Thermo Fisher Scientific
Sourced in United States
Anti-miR™ miRNA inhibitors are a product line designed to inhibit the function of specific microRNA (miRNA) molecules in cells. These inhibitors are synthetic, chemically-modified oligonucleotides that bind to and block the activity of target miRNAs, allowing for the study of miRNA function.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (6 mentions)
Mirvana mirna mimic, by Thermo Fisher Scientific (5 mentions)
Rnaimax, by Thermo Fisher Scientific (5 mentions)
Opti mem, by Thermo Fisher Scientific (5 mentions)
Pre mir mirna precursor, by Thermo Fisher Scientific (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Mirbase v 21, by Thermo Fisher Scientific (2 mentions)
Lipofectamin 2000, by Thermo Fisher Scientific (2 mentions)
Dual luciferaser reporter assay system kit, by Promega (1 mentions)
Dmem culture medium, by PanEco (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Mir 155 mimic, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Tripure isolation reagent, by Roche (1 mentions)
P53 sirna, by Santa Cruz Biotechnology (1 mentions)
X tremegene hp, by Roche (1 mentions)
Nanodrop2000 uv vis spectrophotometers, by Thermo Fisher Scientific (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Siport neofx transfection agent, by Thermo Fisher Scientific (1 mentions)
29 protocols using anti mir mirna inhibitor
1
Validating miR-137 Target Genes
2
Transient Transfection of Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To induce overexpression or knockdown, cells were transiently transfected with either mirVana miRNA Mimic (50 nmol/L), or anti-miR miRNA inhibitor (50 nmol/L) (Thermo Fisher Scientific), and 30 nmol/L of siRNA (Sigma Aldrich) using Lipofectamine RNAi Max (Thermo Fisher Scientific) according to the manufacturers’ protocol. To verify transfection efficiency, mirVana miRNA Mimic Negative Control #1, miRNA inhibitor control and siRNA control were used respectively in each transfection experiment at the same concentration. All transfection experiments were carried out for 72 h.
3
Transfecting Anti-miR-204-5p in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
When PBMCs had reached the final concentration of 1 × 105 cells/ml, transfection experiments were performed using 1.5 μl Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.)/500 μl cell suspension. Anti-miR solutions containing DMEM culture medium supplemented (Paneco, Moscow, Russian Federation) were added to the cells at a final concentration of 25 nM. The medium was replaced 24 h after transfection. Anti-miR™ miRNA Inhibitor Negative Control #1 (5 nmol lyophilized pellets; Thermo Fisher Scientific, Inc.) was used as a control for the miR-204-5p Anti-miR® miRNA Inhibitor (Thermo Fisher Scientific, Inc.). The measurement of miR-204-5p expression is described below. This experiment was repeated three times.
4
Validating miR-192 Regulation of kl-3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full length KL3’UTR in luciferase reporter construct (kl-wt-luc) was a gift from Dr. Gwen King (Creighton University). The miR-192 binding site deletion construct (kl-mut-luc) was cloned using Q5® Site-Directed Mutagenesis Kit Protocol kit (New England Biolabs, Ipswich, MA). The kl-wt-luc or kl-mut-luc construct was co-transfected into HK2 cells with renilla luciferase control (Rluc). The cells were then transfected with either control miRNA or miRNA-192 mimic, or miRNA-192 mimic + inhibitor for 48 hours. The miR-192 inhibitor is a pre-synthesized anti-miR™ miRNA Inhibitor (ThermoFisher. Ambion). anti-miR™ miRNA Inhibitors are chemically modified, single-stranded nucleic acids designed to specifically bind to and inhibit endogenous miRNA molecules. The cells were harvested in lysis buffer and the luciferase activity was measured using Dual-Luciferase® Reporter Assay kit (Promega, Madison, WI).
5
Modulating miRNA-155 in Melanoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LB2201-MEL cells were transfected with 30 nM of miR-155 mimic (Applied Biosystems) with Lipofectamine 2000 Transfection Reagent (Life Technologies) using the manufacturer’s protocol. Cells were collected after 24h or 48h directly in TriPure Isolation Reagent (Roche) for mRNA analyzes and in lysis buffer for protein analyzes. LB2201-MEL cells were transfected with 150 nM of a miR-155 specific Anti-miR miRNA Inhibitor (#AM17000, Applied Biosystem) or a control inhibitor using 1 μl per well of Lipofectamine 2000 Transfection Reagent (Life Technologies) in a final volume of 500 μl in a 12-well plate.
6
Modulating miR-144 Expression in K562 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To study the effects of miR-144, gain and loss were performed. 2×10 5 K562 cells/well with 40 nm hsa-miR-144 miRNA mimic and negative mimic control (mirVana TM miRNA mimic; Applied Biosystem, Foster City, CA, USA) was used to increase miRNA expression. MiR-144 inhibitor with 400 nm and negative miRNA inhibitor (Anti-miR™ miRNA Inhibitor; Applied Biosystem) was used for decrease miRNA expression. MiRNA mimic and inhibitor were transfected to K562 cell using RNAiMAX MiR-144 Regulates Hemoglobin Expression Tipparat PENGLONG et al. http://wjst.wu.ac.th Walailak J Sci & Tech 2020; 17 (11) 1223
(Invitrogen). Cells were harvested at 72 h after transfection. The expression of miR-144, its target and globin genes were examined by qRT-PCR.
(Invitrogen). Cells were harvested at 72 h after transfection. The expression of miR-144, its target and globin genes were examined by qRT-PCR.
7
Identification of positive controls for miRNA screen
8
MicroRNA-31 Transfection Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DLD‐1 and DLD/F cells were seeded in 6‐well plates at a concentration of 0.5 × 105 /well (10%‐30% confluence) on the day before the transfection. The mature types of miR‐31 (has‐miR‐31‐5p, mirVana miRNA mimic; Life Technologies) and anti–miR‐31 (Anti–miR miRNA Inhibitor; Life Technologies) were used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine RNAiMAX (Life Technologies), according to the manufacturer's lipofection protocol. The nonspecific miRNA (mirVana miRNA mimic, Negative Control #1, Life Technologies) was used as a control for nonspecific effects.10 , 15 , 16 , 25 , 26 The sequence of the mature type of miR‐31 used in this study was 5′‐AGGCAAGAUGCUGGCAUAGCU ‐3′. The effects manifested by the introduction of miRs into the cells were assessed at 48 hours after the transfection. The effects manifested by the introduction of miRNAs into the cells were assayed at 48 hours after the transfection by western blot and quantitative RT‐PCR analyses for miRNA.
9
Identification of positive controls for miRNA screen
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-21 (mirVana miRNA mimic, Life Tech, Catalog # 4464066, Assay ID # MC10206) or miR-17 antagomir (Anti-miR miRNA Inhibitor, Life Tech, Catalog # AM12412, Assay ID # AM17000), which are reported mediators of erlotinib resistance were inconsistent at inducing erlotinib resistance in EKVX-pmiR cells between experiments; therefore, the following experiment was conducted to select appropriate positive controls for the screen. The human mirVana library of miRNAs (Invitrogen; based on miRBase v.21) contains 2019 miRNAs individually arrayed in 96-well plates. One of 23 plates that make up the library was randomly selected (Hs Mimic v19-A4–4) and the screening procedure described below was conducted in three biological replicates. Two miRNAs (miR-219b-3p and miR-4749–5p) that enhanced cell growth greater than four-times the standard deviation of the negative control in four replicates were selected as positive controls to be used in the screen and to monitor plate-to-plate variability.
10
miRNA Mimics and Inhibitors Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hsa-mir-139-5p mimic and Negative control were purchased from Gene Pharma (Shanghai, China). Anti-miR miRNA Inhibitor and Anti-miR miRNA Inhibitors—Negative Control were purchased from Ambion. p53 siRNA was purchased from Santa Cruz. Two BIM siRNA (siBIM-1, ID: 19,474 and siBIM-2, ID: 195012) were purchased from Ambion. Transfection of miRNA inhibitors was performed using the same method as that for normal siRNA as described previously (Sun et al., 2008 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!