Phusion site directed mutagenesis kit

Manufactured by New England Biolabs

Sourced in United States

The Phusion Site-Directed Mutagenesis Kit is a tool used for introducing specific mutations into DNA sequences. It provides a simple and efficient method for creating targeted changes in plasmid or viral DNA.

Automatically generated - may contain errors

Lab products found in correlation

Pgem t vector, by Promega (5 mentions) Pmirglo dual luciferase mirna target expression vector, by Promega (1 mentions) Heparin ff column, by GE Healthcare (1 mentions) Hiload superdex g200 16 60 column, by GE Healthcare (1 mentions) Histrap ff column, by GE Healthcare (1 mentions) Pgl4 luciferase reporter vector, by Promega (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Biolux gaussia luciferase flex assay kit, by New England Biolabs (1 mentions) Allstars hs cell death sirna, by Qiagen (1 mentions) Transcriptor high fidelity cdna synthesis kit, by Roche (1 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions) Hiperfect, by Qiagen (1 mentions) Dual luciferase reporter assay system kit, by Promega (1 mentions) Pcr2.1 vector, by Thermo Fisher Scientific (1 mentions) Puc19, by Thermo Fisher Scientific (1 mentions) Endofree plasmid giga kit, by Qiagen (1 mentions) Zymoclean gel dna recovery kit, by Zymo Research (1 mentions)

Close spelling variants of this product

Site-directed mutagenesis

18 protocols using phusion site directed mutagenesis kit

Validation of miR-145 Target Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequence containing three consecutive perfect matches for hsa-miR-145-5p (AGGGATTCCTGGGAAAACTGGACAGCGTAGGGATTCCTGGGAAAACTGGACAGCGTAGGGATTCCTGGGAAAACTGGAC) was excised from the previously produced pSG5-Luc-3xmiR-145 ¹⁵ and subcloned between XhoI–XbaI restriction sites in a pMirGlo dual-luciferase miRNA target expression vector (Promega) to generate pMiRGlo 3xmiR-145.
MOK 3′UTR, MOK CDS, CYR61 3′UTR, HSBP1 3′UTR, RTKN 3′UTR, CTBP1 3′UTR, CTBP1 CDS, FKBP2 CDS, HIST1H4E full-length, GLT8D1 3′UTR, RAB7A 3′UTR, RAB7A CDS, PLOD1 3′UTR, SEC11A 3′UTR, FN3K CDS, UXS1 3′UTR, and DUSP6 3′UTR were amplified by PCR using specific oligonucleotides (sequences available upon request) from HACS cDNA, inserted into the pGEM-T vector (Promega) and subcloned into pMiRGlo.
Three-point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3′UTR using a Phusion^® site-directed mutagenesis kit (NEB) and the mutagenic primers: Forward: 5’-TGTGAGCATGGGTACCCATT-3’ and reverse 5’-CACACACACTTCGTCTTTTATACAAA-3’. Mutated DUSP6 3’UTR was subcloned into pMiRGlo. All the constructs were verified by sequencing.

Martinez-Sanchez A., Lazzarano S., Sharma E., Lockstone H, & Murphy C.L. (2020). High-Throughput Identification of MiR-145 Targets in Human Articular Chondrocytes. Life, 10(5), 58.

+ Open protocol

+ Expand

Purification and Characterization of NtDRM Methyltransferase

Check if the same lab product or an alternative is used in the 5 most similar protocols

A construct encoding the Nicotiana tabacum DRM MTase domain (255-608) was inserted into a self-modified vector, which fuses an N-terminal hexa-histidine plus a yeast sumo tag to the target gene. The plasmid was transformed into E. coli strain BL21 (DE3) RIL (Stratagene). The cells were cultured at 37 °C till OD₆₀₀ reached 1.0, then the media was cooled to 17 °C and 0.2 mM IPTG was added to induce protein expression overnight. The hexa-histidine-sumo tagged protein was initially purified using a HisTrap FF column (GE Healthcare). Then, the tag was cleaved by Ulp1 protease, which was subsequently removed by a second step HisTrap FF column purification. The pooled target protein was further purified by a Heparin FF column (GE Healthcare) and a Hiload Superdex G200 16/60 column (GE Healthcare) with buffer 300 mM NaCl, 20 mM Tris pH 8.0, and 5 mM DTT. The Se-methionine substituted protein was expressed in Se-methionine (Sigma) containing M9 medium and purified using the same protocol as the wild-type protein. The NtDRM-M5 (E283S/R309S/F310S/Y590S/D591S) mutant was generated using a Phusion Site-Directed Mutagenesis Kit (New England Biolabs) and was expressed and purified with the same protocol as the wild-type protein. For enzymatic assays, full length NtDRM (1-608) was cloned into the same vector and expressed and purified with the same protocol as the MTase domain.

Zhong X., Du J., Hale C.J., Gallego-Bartolome J., Feng S., Vashisht A.A., Chory J., Wohlschlegel J.A., Patel D.J, & Jacobsen S.E. (2014). Molecular Mechanism of Action of Plant DRM De Novo DNA Methyltransferases. Cell, 157(5), 1050-1060.

+ Open protocol

+ Expand

Recombinant MauG Variant Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant MauG [5 (link)] and preMADH [6 (link)] were purified from P. denitrificans and Rhodobacter sphaeroides, respectively, as described previously. Thr67of MauG was converted to Ser and Ala by site-directed mutagenesis of double-stranded pMEG391, which contains mauG, using the Phusion site-directed mutagenesis kit (New England Bio Lab). The recombinant MauG variant proteins were homologously expressed in P. denitrificans and isolated from the periplasmic fraction as described for recombinant wild-type (WT) MauG [5 (link)].

Shin S., Feng M., Li C., Williamson H.R., Choi M., Wilmot C.M, & Davidson V.L. (2015). A T67A mutation in the proximal pocket of the high-spin heme of MauG stabilizes formation of a mixed-valent FeII/FeIII state and enhances charge resonance stabilization of the bis-FeIV state. Biochimica et biophysica acta, 1847(8), 709-716.

+ Open protocol

+ Expand

Recombinant Protein Expression Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CHIP, Hop, FKBP51, and FKBP52 were expressed from a pET151 vector such that they contained an N-terminal His-tag and TEV cleavage site. Site-directed mutagenesis for Hop mutants (K8A, R77A, N223A, and R305A) was performed using the Phusion Site-Directed Mutagenesis Kit protocol (New England Biolabs, Ipswich, MA). Human DnaJC7, Hsp72 (HSPA1A), Hsp72ΔEEVD, and E. coli DnaJ were expressed from a pMCSG7 vector with an N-terminal His-tag and TEV cleavage site. Lastly, HIP was expressed from a pET28a vector with an N-terminal His-tag and Thrombin cleavage site.

Assimon V.A., Southworth D.R, & Gestwicki J.E. (2015). Specific binding of tetratricopeptide repeat (TPR) proteins to heat shock protein 70 (Hsp70) and heat shock protein 90 (Hsp90) is regulated by affinity and phosphorylation. Biochemistry, 54(48), 7120-7131.

+ Open protocol

+ Expand

Recombinant Protein Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The BLUF domain of AppA (AppA_BLUF: residues 5-125) was expressed in BL21(DE3) Escherichia coli cells. Protein expression and purification were performed in the dark as described previously^{28 (link)}. The W104Y AppA BLUF construct was obtained by site-directed mutagenesis performed using Phusion site-directed mutagenesis kit (NEB), wt AppA_BLUF in pET15b as a template and the following primers: 5’-CGCCGCTTTGCGGGATATCACATGCAGCTCTCC-3’ and 5’-CTTGGCGATCGGTTCCTCTGCGAGGATCTC-3’. All constructs were verified by DNA sequencing.
C51A and C51A/Y343F mutant proteins of TrmFO from T. thermophilus were heterologously expressed and purified as previously described.^{25 (link)} Glucose oxidase from A. niger was purchased from Sigma and dissolved in the same D2O buffer (50 mM NaH2PO4, 10 mM NaCl, pD 8.0) as the TrmFO and AppA W104Y mutants. All protein concentrations were kept to ~ 1mM and measured in Harrick cells using 50 μm spacers between the CaF₂ windows; in this way ~80 μl sample was used for one measurement.

Pirisi K., Nag L., Fekete Z., Iuliano J.N., Collado J.T., Clark I.P., Pécsi I., Sournia P., Liebl U., Greetham G.M., Tonge P.J., Meech S.R., Vos M.H, & Lukacs A. (2021). Identification of the vibrational marker of tyrosine cation radical using ultrafast transient infrared spectroscopy of flavoprotein systems. Photochemical & photobiological sciences : Official journal of the European Photochemistry Association and the European Society for Photobiology, 20(3), 369-378.

+ Open protocol

+ Expand

Regulation of NGBR Promoter by PPARγ

Check if the same lab product or an alternative is used in the 5 most similar protocols

PPARγ overexpression plasmid was constructed as described (Duan et al., 2012 (link)). Human NGBR promoter (from −983 to +167, pNGBR) sequence was amplified using PCR technic with genomic DNA (extracted from HepG2) and the following primers: forward, 5′-TGCACTCGAGGATGATAGAGGATGTA-3′ and reverse, 5′-TGCCAAGCTTACTCTTGTGGCCCTC-3’. After confirming the sequence, the PCR product was double digested and ligated into the pGL4 luciferase reporter vector (Promega). The pNGBR plasmid with PPRE deletion (pNGBR-PPRE1-del, pNGBR-PPRE2-del, pNGBR-PPREs-del) was designed and constructed using the Phusion site-directed mutagenesis kit (New England Biolabs, Ipswich, MA).
293T cells were seeded into 48-well plate. After reaching ∼90% confluence, the cells were transfected with the corresponding human pNGBR plasmid and Renilla plasmid (20:1) using Lipofectamine™ 3000 (Invitrogen, Waltham, MA, United States). After 12 h, the cells were received the indicated treatment for 24 h in serum-free medium. Then, the cells were harvested and used to determine Firefly and Renilla luciferase activity with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, United States) as described (Yu et al., 2016 (link)).

Ma J., Zeng P., Liu L., Zhu M., Zheng J., Wang C., Zhao X., Hu W., Yang X., Duan Y., Han J., Miao Q.R, & Chen Y. (2022). Peroxisome Proliferator-Activated Receptor-Gamma Reduces ER Stress and Inflammation via Targeting NGBR Expression. Frontiers in Pharmacology, 12, 817784.

+ Open protocol

+ Expand

Rheb(S16H) AAV1 Gene Delivery Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All vectors used in these studies were the AAV1 serotype as previously described [10 (link), 14 (link), 15 (link)]. A plasmid carrying Rheb was purchased from OriGene Technologies (Rockville, MD, USA). Rheb DNA was amplified and modified to incorporate a FLAG-encoding sequence at the 3'-end by expanded long-template PCR (Roche, Basel, Switzerland). Rheb(S16H) was generated with the Phusion Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) in the pGEM-T vector (Promega, Madison, WI, USA), and then cloned into an AAV packaging construct that utilizes the chicken β-actin promoter and contains a 3' WPRE (pBL). AAVs were produced by the University of North Carolina Vector Core, and the genomic titer of Rheb(S16H) was 2×10¹² viral genomes/ml. Enhanced green fluorescent protein (GFP), used as a control, was subcloned into the same viral backbone, and viral stocks were produced at titers of 1×10¹² viral genomes/ml.

Yun D., Jeon M.T., Kim H.J., Moon G.J., Lee S., Ha C.M., Shin M, & Kim S.R. (2020). Induction of GDNF and GFRα-1 Following AAV1-Rheb(S16H) Administration in the Hippocampus in vivo. Experimental Neurobiology, 29(2), 164-175.

+ Open protocol

+ Expand

Constitutively Active Rheb Gene Delivery

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All vectors used for these studies were AAV1 serotypes, as previously described.^{18 (link), 19 (link)} A plasmid carrying the Rheb gene was purchased from OriGene Technologies (Rockville, MD). Rheb DNA was amplified and modified to incorporate a FLAG-encoding sequence at the 3′-end by expanded long-template PCR (Roche, Indianapolis, IN, USA). Constitutively active Rheb [Rheb(S16H)] was generated by use of the Phusion Site-directed Mutagenesis Kit of New England Biolabs (Ipswich, MA, USA), integrated into the pGEM-T vector (Promega, San Luis Obispo, CA, USA), and then cloned into an AAV packaging construct that utilizes the chicken β-actin promoter and contains a 3′ WPRE (pBL). AAVs were produced by the University of North Carolina Vector Core, and the genomic titer was 3.6 × 10¹² viral genomes per ml. Enhanced green fluorescence protein (GFP), used as a control, was subcloned into the same viral backbone, and viral stocks were produced at a titer of 1 × 10¹² viral genomes per ml.

Kim S., Moon G.J., Oh Y.S., Park J., Shin W.H., Jeong J.Y., Choi K.S., Jin B.K., Kholodilov N., Burke R.E., Kim H.J., Ha C.M., Lee S.G, & Kim S.R. (2018). Protection of nigral dopaminergic neurons by AAV1 transduction with Rheb(S16H) against neurotoxic inflammation in vivo. Experimental & Molecular Medicine, 50(2), e440-.

+ Open protocol

+ Expand

DPYD 3'UTR Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT116 RNA was reverse transcribed using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science) using oligo-d(T) primers. The 3′ 56 nucleotides of the open reading frame and the 3′UTR of DPYD were amplified by PCR (Phusion High-Fidelity DNA Polymerase, New England Biolabs, Ipswich, MA) using primers 5′-CAACACCTTATGAACCAAAGAGAGGC-3′ and 5′-ATGCTTTATGATATTTTATTTG-3′ and cloned into the pTK-Gluc vector (New England Biolabs). Mutations were introduced into the predicted microRNA seed-binding sites using the Phusion Site-Directed Mutagenesis Kit (New England Biolabs). Independent clonal cell lines stably expressing each of the reporter constructs were selected using G418 (Mediatech) following transfection of linearized plasmid. MicroRNA mimics and inhibitors were obtained from Qiagen (Valencia, CA) and transfected using HiPerFect (Qiagen) per manufacturer’s instructions. AllStars Hs Cell Death siRNA (Qiagen) was used as a transfection control and to establish residual luciferase activity at time of reading. Luciferase levels were measured after 48 hours using the BioLux Gaussia Luciferase Flex Assay Kit (New England Biolabs). Luciferase activity is reported relative to that for the scramble control. P values were determined using a two-tailed unpaired Student’s t-test.

Offer S.M., Butterfield G.L., Jerde C.R., Fossum C.C., Wegner N.J, & Diasio R.B. (2014). MicroRNAs miR-27a and miR-27b directly regulate liver dihydropyrimidine dehydrogenase expression through two conserved binding sites. Molecular cancer therapeutics, 13(3), 742-751.

+ Open protocol

+ Expand

Dual-Luciferase Assay for VEGF 3'UTR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rat VEGF 3′-UTR (nt1660–3545) was inserted into the Dual-Luciferase reporter vector (pEZX-MT01, Genecopoeia Corp. MD, USA) downstream from the Firefly luciferase (hLuc) reporter gene, and was driven by SV40 Enhancer promoter. In addition, Renilla luciferase (hRLuc) reporter driven by a CMV promoter was cloned into the same vector, serving as the tracking gene and internal control. The dual-reporter vector system enabled transfection-normalization for accurate across-sample comparison. The 293TN cells were assigned into three groups to be transfected with A. pEZX-MT01 vector; B. pEZX-MT01 vector+NC-miR-377 mimic; C. pEZX-MT01 vector+miR-377 mimic. Cell lysates were collected and assayed 48 hours after transfection. Firefly and Renilla luciferase activities were measured using a Dual Luciferase Reporter Assay System kit (Promega Corp. WI, USA) and each transfected well was assayed in triplicate as described [27] (link). The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs. MA, USA) with the following primer, mutated VEGF 3′UTR forward primer 5′-AAGGATAAAATAGACATTGCTATTCTG-3′; reverse primer 5′-AGACTATATACATAAACATATATATATATATATACAC-3′.

Wen Z., Huang W., Feng Y., Cai W., Wang Y., Wang X., Liang J., Wani M., Chen J., Zhu P., Chen J.M., Millard R.W., Fan G.C, & Wang Y. (2014). MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF. PLoS ONE, 9(9), e104666.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!