Gen elute mammalian total rnaminiprep kits

Total RNA was extracted from each individual brain and liver sample using TRI Reagent (Sigma‐Aldrich) and subsequently purified with GenElute™ Mammalian Total RNA MiniPrep Kits (Sigma‐Aldrich), following manufacturer's instructions. We DNase‐treated each sample using the Turbo DNA‐free Kit (Qiagen, UK) to remove residual DNA. We initially assessed the quality and quantity of purified RNA using the NanoDrop 2000 (Thermo Fisher, USA) and the Qubit RNA Broad Range Assay Kit with a Qubit 4 Fluorometer (Thermo Fisher, USA), respectively. Finally, we calculated a relative integrity number (RIN) per sample using an Agilent TapeStation 4200 (Agilent, USA) to ensure purified RNA was not degraded and we only sent samples with a RIN of seven or higher (Sigurgeirsson et al., 2014) for subsequent library preparation and sequencing.

After extracting the total RNA using Gen Elute Mammalian Total RNA
miniprep kits (Sigma), and checking its integrity by electrophoresis, the
cDNA was synthesized from 1 mg of purified total RNA using Revert Aid H
minus first strand cDNA synthesis kit (Fermentas Life Sciences,
Ontario,Canada). Expression of mouse and human IPMK, mouse LC3B, mouse BNIP3
and mouse GAPDH was detected using suitably designed Taqman primers
(Invitrogen).Other genes such as mouse BNIP3L, P62,GABARAPL1 and ATG12 were
determined using primers given in the table. qPCR of these genes was
performed using power Sybr green pcr mater mix from Invitrogen. Expression
of the designated enzymes was normalized against glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as the internal reference. The experiments were
performed (real-time PCR Systems StepOne plus, Applied Biosystems) in
triplicate. Data were quantified for the above genes using the comparative
Ct method, as described in the Assays-on-Demand Users Manual (Applied
Biosystems).
qPCR Primers (Sybr green):
catcgtggagaaggctccta- gabarapl1 (mF)
atacagctggcccatggtag- gabarapl1 (mR)
AACAAAGAAATGGGCTGTGG – ATG12 (mF)
TTGCAGTAATGCAGGACCAG- ATG12 (mR)
CCTCGTCTTCCATCCACAAT- bnip3l (mF)
GTCCCTGCTGGTATGCATCT- bnip3l (mR)
TGGCCACCTCTCTGATAGCT- p62 (mF)
TCATCGTCTCCTCCTGAGCA- p62 (mR)