RNA was extracted from tissue samples using the CinnaPure RNA Extraction Kit (SinaClon, Iran). For cDNA synthesis, 1 μl (0.2 μg) of random hexamer primer (SinaClon, Iran) was added to 5 μl of extracted RNA, and the mixture was heated at 65°C for 5 min. 14 μl of cDNA master mix containing 7.25 μl of DEPC‐treated water (SinaClon, Iran), 2 μl of dNTP mix (SinaClon, Iran), 0.25 μl of RiboLock RNase inhibitor (Thermo Fisher Scientific, USA), 0.5 μl of Revert Aid Reverse Transcriptase (Thermo Fisher Scientific, USA) and 4 μl of 5X RT reaction buffer were added to each tube, resulting in a final volume of 20 μl. The mixture was then incubated at 25°C for 5 min, 42°C for 60 min, 95°C for 5 min and 4°C for 1 min. The cDNA was stored at −20°C until use.
Dntp mix
Manufactured by Sinaclon
The DNTP mix is a laboratory reagent containing a balanced mixture of the four deoxynucleotide triphosphates (dATP, dGTP, dCTP, and dTTP) required for DNA synthesis and amplification. It is a key component in various molecular biology techniques, such as PCR, DNA sequencing, and DNA labeling.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Ribolock rnase inhibitor, by Thermo Fisher Scientific (3 mentions)
Random hexamer primer, by Sinaclon (3 mentions)
Depc treated water, by Sinaclon (3 mentions)
Cinnapure rna extraction kit, by Sinaclon (1 mentions)
Pucm t vector, by Bio Basic (1 mentions)
Taq dna polymerase, by Sinaclon (1 mentions)
4 protocols using dntp mix
1
RNA Extraction and cDNA Synthesis Protocol
2
RNA Extraction and cDNA Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from tissue samples using CinnaPure RNA Extraction Kit (SinaClone, Iran). For cDNA synthesis, 1 µL (0.2 µg) of random hexamer primer (SinaClon, Iran) was added to 5 µL of extracted RNA, and the mixture was heated at 65 °C for 5 minutes. Fourteen µL of cDNA master mix containing 7.25 µL of DEPC-treated water (SinaClon, Iran), 2 µL of dNTP mix (SinaClon, Iran), 0.25 µL of RiboLock RNase Inhibitor (Thermo Fisher Scientific, USA), 0.5 µL of Revert Aid Reverse Transcriptase (Thermo Fisher Scientific, USA), and 4 µL of 5X RT reaction buffer was added to each tube, resulting in a final volume of 20 µL. Then, the mixture was incubated at 25 °C for 5 min, 42 °C for 60 min, 95 °C for 5 min, and 4 °C for 1 min. The cDNA was stored at −20 °C until use. Sampling, RNA extraction, and cDNA synthesis were conducted in Iraq, and the remainder of the work was carried out in Iran.
3
Random Hexamer-Based cDNA Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cDNA synthesis, 1 μL (0.2 ug) of random hexamer primer (SinaClon, Iran) was added to 5 μL of extracted RNA and the mixture was heated at 65°C for 5 minutes. Fourteen μL of cDNA master mix containing 7.25 μL DEPC-treated water (SinaClon, Iran), 2 μL dNTP mix (SinaClon, Iran), 0.25 μL RiboLock RNase Inhibitor (Thermo Fisher Scientific, USA), 0.5 μL Revert Aid Reverse Transcriptase (Thermo Fisher Scientific, USA), and 4 μL 5X RT Reaction Buffer was added to each tube, resulting in a final volume of 20 μL. Then, the mixture was incubated at 25°C for 5 min, 42°C for 60 min, 95°C for 5 min, and 4°C for 1 min, respectively. The cDNA was stored at −20°C until use (10 (link)).
4
Molecular Identification of Bacterial Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
More over Gram staining and microscopic observation, the strain was molecularly identified by 16S rRNA gene sequencing. Genomic DNA was extracted by using Pouya Gene Azma kit (Iran) according to the manufacturer’s instructions. The PCR reaction in a final volume of 25 μL contained: 0.5 μL (250 ng DNA) of the DNA template, 1 μL (10 pmol) from fD1 (AGAGTTTGATCCTGGCTCAG) and rD1 (AAGGAGGTGATCCAGCC) primers (24 (link)), 1 μL dNTP Mix (10 mM; SinaClon, Iran), 0.8 μL Taq DNA polymerase (10 U/μL) (Sina-Clon, Iran), 2.5 μL 10 × Buffer, and 0.75 μL MgCl2 (50 mM). The thermal cycling program was as follows: initial denaturation of 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 51°C for 30 s and 72°C for 1 min, with a final elongation of 72°C for 10 min. PCR product, which was around 1500 bp, was purified using Dena Zist Asia gel extraction kit (Iran), and cloned in pUCM-T vector (Bio Basic, Canada) according to the manufacturer’s protocols. Sanger sequencing was performed in two directions using M13 primers, and the assembled sequence was BLAST against NCBI 16S rRNA database. The most similar sequences were used to construct a phylogenetic tree by the neighbor-joining method with a bootstrap value of 500 (MEGA 11) (25 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!